ID: 1152321515

View in Genome Browser
Species Human (GRCh38)
Location 17:79610747-79610769
Sequence TGAGCTGGGGGAGGGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321515_1152321533 20 Left 1152321515 17:79610747-79610769 CCATGTCCCCCTCCCCCAGCTCA No data
Right 1152321533 17:79610790-79610812 GCAGAGCGAGGCGGGCGACGAGG No data
1152321515_1152321530 12 Left 1152321515 17:79610747-79610769 CCATGTCCCCCTCCCCCAGCTCA No data
Right 1152321530 17:79610782-79610804 TGACCGCCGCAGAGCGAGGCGGG No data
1152321515_1152321528 8 Left 1152321515 17:79610747-79610769 CCATGTCCCCCTCCCCCAGCTCA No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321515_1152321529 11 Left 1152321515 17:79610747-79610769 CCATGTCCCCCTCCCCCAGCTCA No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321515_1152321534 25 Left 1152321515 17:79610747-79610769 CCATGTCCCCCTCCCCCAGCTCA No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321515 Original CRISPR TGAGCTGGGGGAGGGGGACA TGG (reversed) Intergenic