ID: 1152321521

View in Genome Browser
Species Human (GRCh38)
Location 17:79610757-79610779
Sequence CTCCCCCAGCTCAGCCCGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321505_1152321521 22 Left 1152321505 17:79610712-79610734 CCTCCCACTGCGGGGTCCCATGC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321512_1152321521 -3 Left 1152321512 17:79610737-79610759 CCCTCCGCGGCCATGTCCCCCTC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321503_1152321521 26 Left 1152321503 17:79610708-79610730 CCCGCCTCCCACTGCGGGGTCCC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321513_1152321521 -4 Left 1152321513 17:79610738-79610760 CCTCCGCGGCCATGTCCCCCTCC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321509_1152321521 6 Left 1152321509 17:79610728-79610750 CCCATGCGCCCCTCCGCGGCCAT No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321506_1152321521 19 Left 1152321506 17:79610715-79610737 CCCACTGCGGGGTCCCATGCGCC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321511_1152321521 -2 Left 1152321511 17:79610736-79610758 CCCCTCCGCGGCCATGTCCCCCT No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321504_1152321521 25 Left 1152321504 17:79610709-79610731 CCGCCTCCCACTGCGGGGTCCCA No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321510_1152321521 5 Left 1152321510 17:79610729-79610751 CCATGCGCCCCTCCGCGGCCATG No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321514_1152321521 -7 Left 1152321514 17:79610741-79610763 CCGCGGCCATGTCCCCCTCCCCC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data
1152321507_1152321521 18 Left 1152321507 17:79610716-79610738 CCACTGCGGGGTCCCATGCGCCC No data
Right 1152321521 17:79610757-79610779 CTCCCCCAGCTCAGCCCGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321521 Original CRISPR CTCCCCCAGCTCAGCCCGAT GGG Intergenic