ID: 1152321523

View in Genome Browser
Species Human (GRCh38)
Location 17:79610760-79610782
Sequence ATTCCCATCGGGCTGAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321523_1152321536 23 Left 1152321523 17:79610760-79610782 CCCCAGCTCAGCCCGATGGGAAT No data
Right 1152321536 17:79610806-79610828 GACGAGGCCAGGCTACTCACGGG No data
1152321523_1152321529 -2 Left 1152321523 17:79610760-79610782 CCCCAGCTCAGCCCGATGGGAAT No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321523_1152321535 22 Left 1152321523 17:79610760-79610782 CCCCAGCTCAGCCCGATGGGAAT No data
Right 1152321535 17:79610805-79610827 CGACGAGGCCAGGCTACTCACGG No data
1152321523_1152321530 -1 Left 1152321523 17:79610760-79610782 CCCCAGCTCAGCCCGATGGGAAT No data
Right 1152321530 17:79610782-79610804 TGACCGCCGCAGAGCGAGGCGGG No data
1152321523_1152321528 -5 Left 1152321523 17:79610760-79610782 CCCCAGCTCAGCCCGATGGGAAT No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321523_1152321534 12 Left 1152321523 17:79610760-79610782 CCCCAGCTCAGCCCGATGGGAAT No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321523_1152321533 7 Left 1152321523 17:79610760-79610782 CCCCAGCTCAGCCCGATGGGAAT No data
Right 1152321533 17:79610790-79610812 GCAGAGCGAGGCGGGCGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321523 Original CRISPR ATTCCCATCGGGCTGAGCTG GGG (reversed) Intergenic
No off target data available for this crispr