ID: 1152321525

View in Genome Browser
Species Human (GRCh38)
Location 17:79610762-79610784
Sequence TCATTCCCATCGGGCTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321525_1152321530 -3 Left 1152321525 17:79610762-79610784 CCAGCTCAGCCCGATGGGAATGA No data
Right 1152321530 17:79610782-79610804 TGACCGCCGCAGAGCGAGGCGGG No data
1152321525_1152321528 -7 Left 1152321525 17:79610762-79610784 CCAGCTCAGCCCGATGGGAATGA No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321525_1152321536 21 Left 1152321525 17:79610762-79610784 CCAGCTCAGCCCGATGGGAATGA No data
Right 1152321536 17:79610806-79610828 GACGAGGCCAGGCTACTCACGGG No data
1152321525_1152321535 20 Left 1152321525 17:79610762-79610784 CCAGCTCAGCCCGATGGGAATGA No data
Right 1152321535 17:79610805-79610827 CGACGAGGCCAGGCTACTCACGG No data
1152321525_1152321533 5 Left 1152321525 17:79610762-79610784 CCAGCTCAGCCCGATGGGAATGA No data
Right 1152321533 17:79610790-79610812 GCAGAGCGAGGCGGGCGACGAGG No data
1152321525_1152321534 10 Left 1152321525 17:79610762-79610784 CCAGCTCAGCCCGATGGGAATGA No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321525_1152321529 -4 Left 1152321525 17:79610762-79610784 CCAGCTCAGCCCGATGGGAATGA No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321525 Original CRISPR TCATTCCCATCGGGCTGAGC TGG (reversed) Intergenic
No off target data available for this crispr