ID: 1152321527

View in Genome Browser
Species Human (GRCh38)
Location 17:79610772-79610794
Sequence TCTGCGGCGGTCATTCCCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321527_1152321534 0 Left 1152321527 17:79610772-79610794 CCGATGGGAATGACCGCCGCAGA No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321527_1152321533 -5 Left 1152321527 17:79610772-79610794 CCGATGGGAATGACCGCCGCAGA No data
Right 1152321533 17:79610790-79610812 GCAGAGCGAGGCGGGCGACGAGG No data
1152321527_1152321538 28 Left 1152321527 17:79610772-79610794 CCGATGGGAATGACCGCCGCAGA No data
Right 1152321538 17:79610823-79610845 CACGGGCTCAGCGCTCCCCGCGG No data
1152321527_1152321536 11 Left 1152321527 17:79610772-79610794 CCGATGGGAATGACCGCCGCAGA No data
Right 1152321536 17:79610806-79610828 GACGAGGCCAGGCTACTCACGGG No data
1152321527_1152321535 10 Left 1152321527 17:79610772-79610794 CCGATGGGAATGACCGCCGCAGA No data
Right 1152321535 17:79610805-79610827 CGACGAGGCCAGGCTACTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321527 Original CRISPR TCTGCGGCGGTCATTCCCAT CGG (reversed) Intergenic