ID: 1152321528

View in Genome Browser
Species Human (GRCh38)
Location 17:79610778-79610800
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321519_1152321528 -1 Left 1152321519 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321516_1152321528 2 Left 1152321516 17:79610753-79610775 CCCCCTCCCCCAGCTCAGCCCGA No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321510_1152321528 26 Left 1152321510 17:79610729-79610751 CCATGCGCCCCTCCGCGGCCATG No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321525_1152321528 -7 Left 1152321525 17:79610762-79610784 CCAGCTCAGCCCGATGGGAATGA No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321518_1152321528 0 Left 1152321518 17:79610755-79610777 CCCTCCCCCAGCTCAGCCCGATG No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321509_1152321528 27 Left 1152321509 17:79610728-79610750 CCCATGCGCCCCTCCGCGGCCAT No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321511_1152321528 19 Left 1152321511 17:79610736-79610758 CCCCTCCGCGGCCATGTCCCCCT No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321524_1152321528 -6 Left 1152321524 17:79610761-79610783 CCCAGCTCAGCCCGATGGGAATG No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321512_1152321528 18 Left 1152321512 17:79610737-79610759 CCCTCCGCGGCCATGTCCCCCTC No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321514_1152321528 14 Left 1152321514 17:79610741-79610763 CCGCGGCCATGTCCCCCTCCCCC No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321523_1152321528 -5 Left 1152321523 17:79610760-79610782 CCCCAGCTCAGCCCGATGGGAAT No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321522_1152321528 -4 Left 1152321522 17:79610759-79610781 CCCCCAGCTCAGCCCGATGGGAA No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321513_1152321528 17 Left 1152321513 17:79610738-79610760 CCTCCGCGGCCATGTCCCCCTCC No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321517_1152321528 1 Left 1152321517 17:79610754-79610776 CCCCTCCCCCAGCTCAGCCCGAT No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data
1152321515_1152321528 8 Left 1152321515 17:79610747-79610769 CCATGTCCCCCTCCCCCAGCTCA No data
Right 1152321528 17:79610778-79610800 GGAATGACCGCCGCAGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321528 Original CRISPR GGAATGACCGCCGCAGAGCG AGG Intergenic