ID: 1152321529

View in Genome Browser
Species Human (GRCh38)
Location 17:79610781-79610803
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321510_1152321529 29 Left 1152321510 17:79610729-79610751 CCATGCGCCCCTCCGCGGCCATG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321522_1152321529 -1 Left 1152321522 17:79610759-79610781 CCCCCAGCTCAGCCCGATGGGAA No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321517_1152321529 4 Left 1152321517 17:79610754-79610776 CCCCTCCCCCAGCTCAGCCCGAT No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321512_1152321529 21 Left 1152321512 17:79610737-79610759 CCCTCCGCGGCCATGTCCCCCTC No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321516_1152321529 5 Left 1152321516 17:79610753-79610775 CCCCCTCCCCCAGCTCAGCCCGA No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321525_1152321529 -4 Left 1152321525 17:79610762-79610784 CCAGCTCAGCCCGATGGGAATGA No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321519_1152321529 2 Left 1152321519 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321514_1152321529 17 Left 1152321514 17:79610741-79610763 CCGCGGCCATGTCCCCCTCCCCC 0: 1
1: 0
2: 4
3: 71
4: 718
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321513_1152321529 20 Left 1152321513 17:79610738-79610760 CCTCCGCGGCCATGTCCCCCTCC No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321509_1152321529 30 Left 1152321509 17:79610728-79610750 CCCATGCGCCCCTCCGCGGCCAT 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321511_1152321529 22 Left 1152321511 17:79610736-79610758 CCCCTCCGCGGCCATGTCCCCCT No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321518_1152321529 3 Left 1152321518 17:79610755-79610777 CCCTCCCCCAGCTCAGCCCGATG No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321515_1152321529 11 Left 1152321515 17:79610747-79610769 CCATGTCCCCCTCCCCCAGCTCA No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321524_1152321529 -3 Left 1152321524 17:79610761-79610783 CCCAGCTCAGCCCGATGGGAATG No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data
1152321523_1152321529 -2 Left 1152321523 17:79610760-79610782 CCCCAGCTCAGCCCGATGGGAAT No data
Right 1152321529 17:79610781-79610803 ATGACCGCCGCAGAGCGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321529 Original CRISPR ATGACCGCCGCAGAGCGAGG CGG Intergenic