ID: 1152321531

View in Genome Browser
Species Human (GRCh38)
Location 17:79610785-79610807
Sequence TCGCCCGCCTCGCTCTGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321531_1152321539 19 Left 1152321531 17:79610785-79610807 CCGCCGCAGAGCGAGGCGGGCGA No data
Right 1152321539 17:79610827-79610849 GGCTCAGCGCTCCCCGCGGCAGG No data
1152321531_1152321543 29 Left 1152321531 17:79610785-79610807 CCGCCGCAGAGCGAGGCGGGCGA No data
Right 1152321543 17:79610837-79610859 TCCCCGCGGCAGGTGACTGGGGG No data
1152321531_1152321541 27 Left 1152321531 17:79610785-79610807 CCGCCGCAGAGCGAGGCGGGCGA No data
Right 1152321541 17:79610835-79610857 GCTCCCCGCGGCAGGTGACTGGG No data
1152321531_1152321536 -2 Left 1152321531 17:79610785-79610807 CCGCCGCAGAGCGAGGCGGGCGA No data
Right 1152321536 17:79610806-79610828 GACGAGGCCAGGCTACTCACGGG No data
1152321531_1152321535 -3 Left 1152321531 17:79610785-79610807 CCGCCGCAGAGCGAGGCGGGCGA No data
Right 1152321535 17:79610805-79610827 CGACGAGGCCAGGCTACTCACGG No data
1152321531_1152321542 28 Left 1152321531 17:79610785-79610807 CCGCCGCAGAGCGAGGCGGGCGA No data
Right 1152321542 17:79610836-79610858 CTCCCCGCGGCAGGTGACTGGGG No data
1152321531_1152321538 15 Left 1152321531 17:79610785-79610807 CCGCCGCAGAGCGAGGCGGGCGA No data
Right 1152321538 17:79610823-79610845 CACGGGCTCAGCGCTCCCCGCGG No data
1152321531_1152321540 26 Left 1152321531 17:79610785-79610807 CCGCCGCAGAGCGAGGCGGGCGA No data
Right 1152321540 17:79610834-79610856 CGCTCCCCGCGGCAGGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321531 Original CRISPR TCGCCCGCCTCGCTCTGCGG CGG (reversed) Intergenic