ID: 1152321534

View in Genome Browser
Species Human (GRCh38)
Location 17:79610795-79610817
Sequence GCGAGGCGGGCGACGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321515_1152321534 25 Left 1152321515 17:79610747-79610769 CCATGTCCCCCTCCCCCAGCTCA No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321522_1152321534 13 Left 1152321522 17:79610759-79610781 CCCCCAGCTCAGCCCGATGGGAA No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321526_1152321534 1 Left 1152321526 17:79610771-79610793 CCCGATGGGAATGACCGCCGCAG No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321525_1152321534 10 Left 1152321525 17:79610762-79610784 CCAGCTCAGCCCGATGGGAATGA No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321517_1152321534 18 Left 1152321517 17:79610754-79610776 CCCCTCCCCCAGCTCAGCCCGAT No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321523_1152321534 12 Left 1152321523 17:79610760-79610782 CCCCAGCTCAGCCCGATGGGAAT No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321518_1152321534 17 Left 1152321518 17:79610755-79610777 CCCTCCCCCAGCTCAGCCCGATG No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321524_1152321534 11 Left 1152321524 17:79610761-79610783 CCCAGCTCAGCCCGATGGGAATG No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321527_1152321534 0 Left 1152321527 17:79610772-79610794 CCGATGGGAATGACCGCCGCAGA No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321516_1152321534 19 Left 1152321516 17:79610753-79610775 CCCCCTCCCCCAGCTCAGCCCGA No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data
1152321519_1152321534 16 Left 1152321519 17:79610756-79610778 CCTCCCCCAGCTCAGCCCGATGG No data
Right 1152321534 17:79610795-79610817 GCGAGGCGGGCGACGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321534 Original CRISPR GCGAGGCGGGCGACGAGGCC AGG Intergenic