ID: 1152321538

View in Genome Browser
Species Human (GRCh38)
Location 17:79610823-79610845
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321526_1152321538 29 Left 1152321526 17:79610771-79610793 CCCGATGGGAATGACCGCCGCAG No data
Right 1152321538 17:79610823-79610845 CACGGGCTCAGCGCTCCCCGCGG No data
1152321527_1152321538 28 Left 1152321527 17:79610772-79610794 CCGATGGGAATGACCGCCGCAGA No data
Right 1152321538 17:79610823-79610845 CACGGGCTCAGCGCTCCCCGCGG No data
1152321531_1152321538 15 Left 1152321531 17:79610785-79610807 CCGCCGCAGAGCGAGGCGGGCGA No data
Right 1152321538 17:79610823-79610845 CACGGGCTCAGCGCTCCCCGCGG No data
1152321532_1152321538 12 Left 1152321532 17:79610788-79610810 CCGCAGAGCGAGGCGGGCGACGA No data
Right 1152321538 17:79610823-79610845 CACGGGCTCAGCGCTCCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321538 Original CRISPR CACGGGCTCAGCGCTCCCCG CGG Intergenic