ID: 1152321575

View in Genome Browser
Species Human (GRCh38)
Location 17:79610936-79610958
Sequence CCTCGCGCGCCCCTTGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321575_1152321583 0 Left 1152321575 17:79610936-79610958 CCAGCGGCAAGGGGCGCGCGAGG No data
Right 1152321583 17:79610959-79610981 CCGGGCTCGGGCGGCAGCTGTGG No data
1152321575_1152321581 -9 Left 1152321575 17:79610936-79610958 CCAGCGGCAAGGGGCGCGCGAGG No data
Right 1152321581 17:79610950-79610972 CGCGCGAGGCCGGGCTCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321575 Original CRISPR CCTCGCGCGCCCCTTGCCGC TGG (reversed) Intergenic
No off target data available for this crispr