ID: 1152321581

View in Genome Browser
Species Human (GRCh38)
Location 17:79610950-79610972
Sequence CGCGCGAGGCCGGGCTCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152321574_1152321581 -1 Left 1152321574 17:79610928-79610950 CCGGCGAGCCAGCGGCAAGGGGC No data
Right 1152321581 17:79610950-79610972 CGCGCGAGGCCGGGCTCGGGCGG No data
1152321575_1152321581 -9 Left 1152321575 17:79610936-79610958 CCAGCGGCAAGGGGCGCGCGAGG No data
Right 1152321581 17:79610950-79610972 CGCGCGAGGCCGGGCTCGGGCGG No data
1152321568_1152321581 17 Left 1152321568 17:79610910-79610932 CCTGGGGCCGCACAGGCACCGGC No data
Right 1152321581 17:79610950-79610972 CGCGCGAGGCCGGGCTCGGGCGG No data
1152321569_1152321581 10 Left 1152321569 17:79610917-79610939 CCGCACAGGCACCGGCGAGCCAG No data
Right 1152321581 17:79610950-79610972 CGCGCGAGGCCGGGCTCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152321581 Original CRISPR CGCGCGAGGCCGGGCTCGGG CGG Intergenic
No off target data available for this crispr