ID: 1152322390

View in Genome Browser
Species Human (GRCh38)
Location 17:79615098-79615120
Sequence CTCGTTCCTGCTCTTTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152322390_1152322393 8 Left 1152322390 17:79615098-79615120 CCATAAAAAAGAGCAGGAACGAG No data
Right 1152322393 17:79615129-79615151 CAGAATTCTCAACACAAAGAGGG No data
1152322390_1152322392 7 Left 1152322390 17:79615098-79615120 CCATAAAAAAGAGCAGGAACGAG No data
Right 1152322392 17:79615128-79615150 CCAGAATTCTCAACACAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152322390 Original CRISPR CTCGTTCCTGCTCTTTTTTA TGG (reversed) Intergenic
No off target data available for this crispr