ID: 1152322733

View in Genome Browser
Species Human (GRCh38)
Location 17:79617258-79617280
Sequence GACCCCCCCATCCCCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152322733_1152322735 7 Left 1152322733 17:79617258-79617280 CCTGCTCTGGGGATGGGGGGGTC No data
Right 1152322735 17:79617288-79617310 ACCAGCCTAAAAACCTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152322733 Original CRISPR GACCCCCCCATCCCCAGAGC AGG (reversed) Intergenic
No off target data available for this crispr