ID: 1152322735

View in Genome Browser
Species Human (GRCh38)
Location 17:79617288-79617310
Sequence ACCAGCCTAAAAACCTTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152322723_1152322735 21 Left 1152322723 17:79617244-79617266 CCTCTTCTGTCTTTCCTGCTCTG No data
Right 1152322735 17:79617288-79617310 ACCAGCCTAAAAACCTTATCTGG No data
1152322733_1152322735 7 Left 1152322733 17:79617258-79617280 CCTGCTCTGGGGATGGGGGGGTC No data
Right 1152322735 17:79617288-79617310 ACCAGCCTAAAAACCTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152322735 Original CRISPR ACCAGCCTAAAAACCTTATC TGG Intergenic
No off target data available for this crispr