ID: 1152325165

View in Genome Browser
Species Human (GRCh38)
Location 17:79631802-79631824
Sequence CAGGGGGAGCAGCCTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152325165_1152325176 2 Left 1152325165 17:79631802-79631824 CCACCCTCAGGCTGCTCCCCCTG No data
Right 1152325176 17:79631827-79631849 AGAAGGATGCCAGCTCTGTGGGG No data
1152325165_1152325177 9 Left 1152325165 17:79631802-79631824 CCACCCTCAGGCTGCTCCCCCTG No data
Right 1152325177 17:79631834-79631856 TGCCAGCTCTGTGGGGTCCCTGG No data
1152325165_1152325174 0 Left 1152325165 17:79631802-79631824 CCACCCTCAGGCTGCTCCCCCTG No data
Right 1152325174 17:79631825-79631847 GAAGAAGGATGCCAGCTCTGTGG No data
1152325165_1152325175 1 Left 1152325165 17:79631802-79631824 CCACCCTCAGGCTGCTCCCCCTG No data
Right 1152325175 17:79631826-79631848 AAGAAGGATGCCAGCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152325165 Original CRISPR CAGGGGGAGCAGCCTGAGGG TGG (reversed) Intergenic
No off target data available for this crispr