ID: 1152325186

View in Genome Browser
Species Human (GRCh38)
Location 17:79631887-79631909
Sequence CTGCTGGGTACCCTCCGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152325186_1152325198 22 Left 1152325186 17:79631887-79631909 CCCTGACGGAGGGTACCCAGCAG No data
Right 1152325198 17:79631932-79631954 CCCAGAGAATGAACAGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152325186 Original CRISPR CTGCTGGGTACCCTCCGTCA GGG (reversed) Intergenic
No off target data available for this crispr