ID: 1152325633

View in Genome Browser
Species Human (GRCh38)
Location 17:79634261-79634283
Sequence CAGTGGCTCTGGCGGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152325633_1152325641 -5 Left 1152325633 17:79634261-79634283 CCACCTCACCGCCAGAGCCACTG No data
Right 1152325641 17:79634279-79634301 CACTGGTGAGCAGGAAAGGCTGG No data
1152325633_1152325639 -9 Left 1152325633 17:79634261-79634283 CCACCTCACCGCCAGAGCCACTG No data
Right 1152325639 17:79634275-79634297 GAGCCACTGGTGAGCAGGAAAGG No data
1152325633_1152325643 -3 Left 1152325633 17:79634261-79634283 CCACCTCACCGCCAGAGCCACTG No data
Right 1152325643 17:79634281-79634303 CTGGTGAGCAGGAAAGGCTGGGG No data
1152325633_1152325642 -4 Left 1152325633 17:79634261-79634283 CCACCTCACCGCCAGAGCCACTG No data
Right 1152325642 17:79634280-79634302 ACTGGTGAGCAGGAAAGGCTGGG No data
1152325633_1152325644 21 Left 1152325633 17:79634261-79634283 CCACCTCACCGCCAGAGCCACTG No data
Right 1152325644 17:79634305-79634327 ACCTCCCCTCGTCTACCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152325633 Original CRISPR CAGTGGCTCTGGCGGTGAGG TGG (reversed) Intergenic
No off target data available for this crispr