ID: 1152326136

View in Genome Browser
Species Human (GRCh38)
Location 17:79638824-79638846
Sequence CCACTCATGTAGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152326136_1152326143 13 Left 1152326136 17:79638824-79638846 CCCTTCACCTTCTACATGAGTGG No data
Right 1152326143 17:79638860-79638882 CCCTCATGAGAAGCAGATGCTGG 0: 3
1: 46
2: 360
3: 760
4: 1066
1152326136_1152326140 -10 Left 1152326136 17:79638824-79638846 CCCTTCACCTTCTACATGAGTGG No data
Right 1152326140 17:79638837-79638859 ACATGAGTGGCAGCAACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152326136 Original CRISPR CCACTCATGTAGAAGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr