ID: 1152326136 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:79638824-79638846 |
| Sequence | CCACTCATGTAGAAGGTGAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1152326136_1152326143 | 13 | Left | 1152326136 | 17:79638824-79638846 | CCCTTCACCTTCTACATGAGTGG | No data | ||
| Right | 1152326143 | 17:79638860-79638882 | CCCTCATGAGAAGCAGATGCTGG | 0: 3 1: 46 2: 360 3: 760 4: 1066 |
||||
| 1152326136_1152326140 | -10 | Left | 1152326136 | 17:79638824-79638846 | CCCTTCACCTTCTACATGAGTGG | No data | ||
| Right | 1152326140 | 17:79638837-79638859 | ACATGAGTGGCAGCAACCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1152326136 | Original CRISPR | CCACTCATGTAGAAGGTGAA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||