ID: 1152326709

View in Genome Browser
Species Human (GRCh38)
Location 17:79645714-79645736
Sequence CCTCCTTCACTTAAGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152326698_1152326709 25 Left 1152326698 17:79645666-79645688 CCAGTTCACCGTCTTTCCCTTAA No data
Right 1152326709 17:79645714-79645736 CCTCCTTCACTTAAGGCACAGGG No data
1152326702_1152326709 8 Left 1152326702 17:79645683-79645705 CCTTAAACACTTGCTGCCTGGAC No data
Right 1152326709 17:79645714-79645736 CCTCCTTCACTTAAGGCACAGGG No data
1152326704_1152326709 -8 Left 1152326704 17:79645699-79645721 CCTGGACCGCAGCGGCCTCCTTC No data
Right 1152326709 17:79645714-79645736 CCTCCTTCACTTAAGGCACAGGG No data
1152326701_1152326709 9 Left 1152326701 17:79645682-79645704 CCCTTAAACACTTGCTGCCTGGA No data
Right 1152326709 17:79645714-79645736 CCTCCTTCACTTAAGGCACAGGG No data
1152326699_1152326709 17 Left 1152326699 17:79645674-79645696 CCGTCTTTCCCTTAAACACTTGC No data
Right 1152326709 17:79645714-79645736 CCTCCTTCACTTAAGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152326709 Original CRISPR CCTCCTTCACTTAAGGCACA GGG Intergenic
No off target data available for this crispr