ID: 1152330065

View in Genome Browser
Species Human (GRCh38)
Location 17:79667643-79667665
Sequence AAACGAAGACAGATGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152330062_1152330065 -3 Left 1152330062 17:79667623-79667645 CCTCAGGATGCTGATGAGATAAA No data
Right 1152330065 17:79667643-79667665 AAACGAAGACAGATGGGCCATGG No data
1152330061_1152330065 4 Left 1152330061 17:79667616-79667638 CCTTTGGCCTCAGGATGCTGATG No data
Right 1152330065 17:79667643-79667665 AAACGAAGACAGATGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152330065 Original CRISPR AAACGAAGACAGATGGGCCA TGG Intergenic
No off target data available for this crispr