ID: 1152330549

View in Genome Browser
Species Human (GRCh38)
Location 17:79670181-79670203
Sequence CAGTGAATGCAGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152330549_1152330557 30 Left 1152330549 17:79670181-79670203 CCCACTTCCCTCTGCATTCACTG No data
Right 1152330557 17:79670234-79670256 ACCTCTCATCAGATGCAGATTGG No data
1152330549_1152330554 -10 Left 1152330549 17:79670181-79670203 CCCACTTCCCTCTGCATTCACTG No data
Right 1152330554 17:79670194-79670216 GCATTCACTGGCCCAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152330549 Original CRISPR CAGTGAATGCAGAGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr