ID: 1152332384

View in Genome Browser
Species Human (GRCh38)
Location 17:79680700-79680722
Sequence CTCCCCTGCAGGGCCATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152332379_1152332384 6 Left 1152332379 17:79680671-79680693 CCTGTGCTGGTGAGAACGTGGCT No data
Right 1152332384 17:79680700-79680722 CTCCCCTGCAGGGCCATCTGGGG No data
1152332376_1152332384 14 Left 1152332376 17:79680663-79680685 CCCGAAATCCTGTGCTGGTGAGA No data
Right 1152332384 17:79680700-79680722 CTCCCCTGCAGGGCCATCTGGGG No data
1152332377_1152332384 13 Left 1152332377 17:79680664-79680686 CCGAAATCCTGTGCTGGTGAGAA No data
Right 1152332384 17:79680700-79680722 CTCCCCTGCAGGGCCATCTGGGG No data
1152332375_1152332384 15 Left 1152332375 17:79680662-79680684 CCCCGAAATCCTGTGCTGGTGAG No data
Right 1152332384 17:79680700-79680722 CTCCCCTGCAGGGCCATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152332384 Original CRISPR CTCCCCTGCAGGGCCATCTG GGG Intergenic