ID: 1152337886

View in Genome Browser
Species Human (GRCh38)
Location 17:79708273-79708295
Sequence GTCCTGCGGGAGGCCCGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152337886_1152337899 15 Left 1152337886 17:79708273-79708295 CCATCACGGGCCTCCCGCAGGAC No data
Right 1152337899 17:79708311-79708333 CTTCCATTGACCAAGGTCGGGGG No data
1152337886_1152337898 14 Left 1152337886 17:79708273-79708295 CCATCACGGGCCTCCCGCAGGAC No data
Right 1152337898 17:79708310-79708332 GCTTCCATTGACCAAGGTCGGGG No data
1152337886_1152337896 12 Left 1152337886 17:79708273-79708295 CCATCACGGGCCTCCCGCAGGAC No data
Right 1152337896 17:79708308-79708330 CAGCTTCCATTGACCAAGGTCGG No data
1152337886_1152337897 13 Left 1152337886 17:79708273-79708295 CCATCACGGGCCTCCCGCAGGAC No data
Right 1152337897 17:79708309-79708331 AGCTTCCATTGACCAAGGTCGGG No data
1152337886_1152337895 8 Left 1152337886 17:79708273-79708295 CCATCACGGGCCTCCCGCAGGAC No data
Right 1152337895 17:79708304-79708326 AGAGCAGCTTCCATTGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152337886 Original CRISPR GTCCTGCGGGAGGCCCGTGA TGG (reversed) Intergenic
No off target data available for this crispr