ID: 1152342776

View in Genome Browser
Species Human (GRCh38)
Location 17:79734338-79734360
Sequence CCTGCTCACCAGCCGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152342776_1152342783 8 Left 1152342776 17:79734338-79734360 CCTTCCACCGGCTGGTGAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 156
Right 1152342783 17:79734369-79734391 GTAGAGACCCTGGCATCACAAGG 0: 1
1: 0
2: 0
3: 7
4: 122
1152342776_1152342781 -2 Left 1152342776 17:79734338-79734360 CCTTCCACCGGCTGGTGAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 156
Right 1152342781 17:79734359-79734381 GGAAGCCAAGGTAGAGACCCTGG 0: 1
1: 0
2: 5
3: 37
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152342776 Original CRISPR CCTGCTCACCAGCCGGTGGA AGG (reversed) Intronic
900400659 1:2471652-2471674 CCTGCTCTGGGGCCGGTGGAAGG + Intronic
900592180 1:3465065-3465087 CCTGCACCCCAGCAGCTGGAAGG + Intronic
901935225 1:12621945-12621967 CCTGCTCAAGAGCTGGAGGAAGG - Intergenic
903177491 1:21589764-21589786 CCAGCTGACCAGGCTGTGGATGG - Intergenic
903500084 1:23795887-23795909 CCTGCTCTCCAGCCTCTGGCAGG - Exonic
903596967 1:24502675-24502697 CCTGGTCCCCAGCCTGTGGGGGG - Intronic
904475472 1:30762130-30762152 CCTACTCCCCTGCCTGTGGAAGG + Intergenic
904717617 1:32480819-32480841 CCTGGCTACCCGCCGGTGGATGG - Intronic
905415904 1:37804048-37804070 CCTGCTCACCAGCCTCTGGTGGG - Intronic
905947544 1:41916763-41916785 CCTGCTGAGCAGCCAGTGTAGGG - Intronic
912246059 1:107963473-107963495 ACTGCCCACCAGCAGGTTGAAGG + Intronic
915217391 1:154349293-154349315 CTAGCTCCCCAGCTGGTGGAAGG - Exonic
916496723 1:165354258-165354280 CCAGCTCCCGAGCCGGTGGCCGG - Intronic
917796233 1:178534652-178534674 CCTGCTCACCAGGCCTTGGTGGG + Intronic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1067289619 10:44931687-44931709 CCTGGTGACCAGCAGGTAGAAGG + Intronic
1069818798 10:71214979-71215001 CCTGCCCACCAGCCTGGAGAGGG + Intronic
1070364500 10:75723243-75723265 CCAGCTCACCAGCCAGTTCATGG - Intronic
1070519067 10:77236046-77236068 CCTGCTCCCCTGGAGGTGGATGG - Intronic
1071492920 10:86148219-86148241 GGTGGTCACCAGCCGATGGATGG + Intronic
1071504114 10:86222540-86222562 CCTGCTCCCCAGCTGCTGGGTGG - Intronic
1072605546 10:96979070-96979092 ACTGCTCAGAAGCCAGTGGAGGG + Intronic
1073118893 10:101109101-101109123 ACTGCACTCCAGCCTGTGGATGG + Intronic
1076097200 10:127740955-127740977 TCTGCTCACCTGCTTGTGGAGGG - Exonic
1076904360 10:133354869-133354891 CCTGCCCTCCTGCGGGTGGAAGG + Intergenic
1078088822 11:8251308-8251330 CGTGCTCACCAGCCTGTTTATGG + Intronic
1079111622 11:17608206-17608228 CCTGCCCCCCATCCTGTGGAGGG - Intronic
1079281309 11:19089600-19089622 CCAGCTCACCTGCTGTTGGAGGG + Intergenic
1079441244 11:20516786-20516808 CATGTTCACCAGCAGGTGAATGG - Intergenic
1081152684 11:39651924-39651946 CCTGCTCAGCTCCCGGTGGGAGG + Intergenic
1081991748 11:47341630-47341652 CCTGGTCACAAGCTGGGGGAGGG + Intronic
1084409932 11:69001077-69001099 CCTTGTCACCAGCCCGTCGAAGG + Intergenic
1084691757 11:70731643-70731665 GATGCCCACCAGCAGGTGGATGG - Intronic
1088531712 11:110817783-110817805 CTTGCTCACCAACAGCTGGATGG - Intergenic
1089104471 11:115990744-115990766 CCAGCTCCCCAGCAGCTGGAAGG - Intergenic
1095945782 12:47752435-47752457 CCTGCTCATGGGCCTGTGGAAGG - Intronic
1096255401 12:50059114-50059136 CCTGCTCAACAACAGGTGGGTGG + Exonic
1098731429 12:74040376-74040398 CCTGCTCCTCAGCTTGTGGACGG + Intergenic
1100518564 12:95351794-95351816 CCTGCTCTCCAGCCTGGAGAGGG - Intergenic
1102652128 12:114449444-114449466 CCTGCCCACCAGCTAGTGGCGGG - Intergenic
1105216589 13:18290510-18290532 CCTGATCACCAGCAGGTTGGAGG + Intergenic
1105804628 13:23945967-23945989 CCTGCTCAGGAGCCGGTGGTTGG - Intergenic
1107011579 13:35675860-35675882 CATGCTCACCAGATGGTGGGAGG - Intergenic
1113124812 13:106965667-106965689 CCTGGTCTCCAGCTGGTGAATGG - Intergenic
1119294422 14:73521427-73521449 CCTGTCCACCACCAGGTGGATGG - Intronic
1119523901 14:75307094-75307116 CCTGCTCTCCACACGGTGGCAGG + Intergenic
1121675105 14:95746058-95746080 CCTGGTCACCAGGTGTTGGAGGG + Intergenic
1122425943 14:101605286-101605308 GCTGGTCACCAGTGGGTGGAGGG - Intergenic
1126462341 15:48927312-48927334 CCTGCTCTCCAGCCTGTGTGGGG - Intronic
1128567625 15:68711637-68711659 CCTGCTCACCACCACGTGCAAGG + Exonic
1129742108 15:77994290-77994312 CCTGCTCCCCACCCCTTGGAAGG - Intronic
1129843375 15:78757179-78757201 CCTGCTCCCCACCCCTTGGAAGG + Intergenic
1131540891 15:93274379-93274401 CCTGCTAACCAGCTGGGGGAGGG + Intergenic
1131831694 15:96358932-96358954 CCAGCTCCCCAGCTGGTTGAGGG + Intergenic
1133029792 16:3004866-3004888 CCTACTCACCCGCCGCGGGAGGG - Intergenic
1134571991 16:15298983-15299005 CCTGCTAACCTCCAGGTGGAAGG - Intergenic
1134730390 16:16457060-16457082 CCTGCTAACCTCCAGGTGGAAGG + Intergenic
1134937041 16:18254836-18254858 CCTGCTAACCTCCAGGTGGAAGG - Intergenic
1136292634 16:29285177-29285199 CCCACTCACAAGCCGGTGGGTGG - Intergenic
1136620014 16:31422395-31422417 CCTGTGCACAAGCCTGTGGAAGG - Intronic
1137270099 16:46897724-46897746 GCGGCTCACCTGCCGGAGGAAGG - Exonic
1137497820 16:48984289-48984311 CCTGCAGACCTGCTGGTGGAAGG + Intergenic
1139796397 16:69486385-69486407 TCTGCTCCCCTGCCTGTGGAAGG + Intergenic
1140132848 16:72179176-72179198 CCTGCTCTCCAGCAGGAGAAGGG + Intergenic
1140214991 16:73000099-73000121 GCTGCTCTCCAACAGGTGGAGGG + Intronic
1141665447 16:85463134-85463156 CCAGCTCACCGCCCCGTGGACGG + Intergenic
1142098525 16:88259192-88259214 CCCACTCACAAGCCGGTGGGTGG - Intergenic
1142134859 16:88447147-88447169 CCTGCTGACCTGCTGGTGGGTGG - Intergenic
1142836893 17:2593936-2593958 CCCCCTCCCCCGCCGGTGGATGG + Exonic
1143015887 17:3890980-3891002 CCTCCACACCAGCTGCTGGAGGG + Intronic
1143575883 17:7792807-7792829 CCTGCCCTCCAGCCAGTGGTCGG + Exonic
1145002524 17:19315202-19315224 CCTGTTCACCAGCCAAAGGAGGG - Intronic
1145012727 17:19378821-19378843 CCTGCTCCCCAGCCCGCAGAGGG + Intronic
1145314479 17:21721231-21721253 CTTGCTCTCCAGCCACTGGAAGG + Intergenic
1147741614 17:42673676-42673698 CGTGCTCACCAGCCTGTGCTCGG - Exonic
1148439904 17:47706556-47706578 CCTGCTCACCATCAGATGGGTGG + Intronic
1148551735 17:48554699-48554721 CCAGCACACCAGCCGGCCGAGGG + Intronic
1150298930 17:64032344-64032366 CCAGCTCAGCAGGAGGTGGATGG - Intergenic
1152258487 17:79254034-79254056 CCTTCTCCCCAGCTGGTGGCAGG + Intronic
1152342776 17:79734338-79734360 CCTGCTCACCAGCCGGTGGAAGG - Intronic
1152741363 17:82019895-82019917 CCTGCTCACCAGCTCCTAGAAGG + Exonic
1152927547 17:83094310-83094332 TCTGCTCACGCGCAGGTGGATGG - Exonic
1154295033 18:13140165-13140187 CCTGTTCACCAACCACTGGAAGG - Intergenic
1155428069 18:25726617-25726639 CCTGCTCACCAGAGTGGGGAAGG - Intergenic
1160179342 18:76620341-76620363 CCTGCTCCCCAGCACGTGGGGGG - Intergenic
1161134948 19:2614114-2614136 CATCCTCACCACCCGGTGAACGG + Intronic
1163852961 19:19676569-19676591 CCTGCACACCAGGTGGTGGGAGG + Intronic
1164615147 19:29663265-29663287 GCTTGTCACCAGCGGGTGGAGGG - Intergenic
1165078138 19:33292016-33292038 CCTTCTCACCAGCAAGGGGAAGG + Intergenic
1167688265 19:50969602-50969624 CCTGCTCCCCAGCCCGGGGCAGG - Intronic
1167959757 19:53096401-53096423 TCTGCTTACCAACCTGTGGAAGG + Intronic
1167963557 19:53126242-53126264 TCTGCTTACCAACCTGTGGAAGG + Intronic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
926690641 2:15731018-15731040 CCTGCTTCCCAGCTGCTGGAGGG + Intronic
929486624 2:42360883-42360905 CCTGCTCACCTGGCGGGGGCTGG - Intronic
929787174 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG + Intergenic
930025218 2:47025415-47025437 CATGCTCACCAGCCGGGGCTTGG + Intronic
932766320 2:74472749-74472771 CCTGCTAAGCAGCCGGCGGCCGG - Exonic
933655680 2:84885087-84885109 CCTGCACACCTGGCAGTGGAGGG - Intronic
934297734 2:91756168-91756190 CCTGATCACCAGCAGGTTGGAGG - Intergenic
934500476 2:94857193-94857215 CCCGCTCAAGAGCCGGTGGTTGG - Intergenic
938237342 2:129717063-129717085 CCTGCACACCAGACTGTGGGAGG - Intergenic
938259398 2:129884419-129884441 CCTGCCCACCAGCCTGAGGGTGG - Intergenic
938259407 2:129884449-129884471 CCTGCCCACCAGCCTGAGGGTGG - Intergenic
939420056 2:141955597-141955619 GCTGCTCACTGGCCAGTGGAAGG + Intronic
947739181 2:232477155-232477177 CCTGCTCACAAAGCTGTGGATGG + Intergenic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1172311094 20:33918948-33918970 CCTCCTCACCACCCCTTGGAGGG + Intergenic
1172742998 20:37183997-37184019 CCTGCTCTTCAACTGGTGGAAGG - Intronic
1174251591 20:49223913-49223935 ACTGCACTCCAGCCTGTGGATGG - Intronic
1174336538 20:49865602-49865624 GATGCTCACCAGCTGGAGGAGGG + Intronic
1175890152 20:62312391-62312413 GCTGCTCACCAGCAGGTCGGCGG + Exonic
1176888979 21:14291345-14291367 CGTACTCACAAGCCAGTGGAAGG + Intergenic
1177504577 21:22002984-22003006 CCTGCACTCCAGCCGGGAGAGGG + Intergenic
1179626521 21:42652622-42652644 CCTGGTCTCCACCTGGTGGACGG - Intergenic
1179891007 21:44335089-44335111 ACTGCCCACCAGACGCTGGATGG - Intronic
1180008675 21:45035207-45035229 CCAGGTCACCTGCCTGTGGAGGG - Intergenic
1180868762 22:19134415-19134437 CCTGCTCACAAGGCGCTGTAGGG + Exonic
1181465073 22:23106572-23106594 CCTCCTCACTAGCCAGGGGAGGG - Intronic
1182123053 22:27799293-27799315 CCGGTTCTCCAGCCGGTGGATGG + Exonic
1184093100 22:42302543-42302565 CAAGGTCACCAGCCAGTGGAAGG + Intronic
1184384479 22:44166518-44166540 CCTACTCATCTGCCGCTGGACGG + Intronic
1184772730 22:46607439-46607461 CCTACACACCAGCCTGTGGAGGG - Intronic
1184783663 22:46661542-46661564 CCTGCCCACCTGCTGGGGGAGGG - Intronic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1185119693 22:48958581-48958603 CCTGCCCAGCAGCCAGAGGAGGG - Intergenic
1185363359 22:50422713-50422735 CCTGCTCAGCAGCATGTTGAGGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
964423695 3:156530891-156530913 ACTGCTCACCAGCAGATGGCTGG - Intronic
968554311 4:1239517-1239539 TCTGCTCACCTGCAGGCGGATGG - Intronic
968914529 4:3491652-3491674 CCTGCCCACCAGCTTGTGGCTGG + Intronic
969483954 4:7461350-7461372 CCGCCTCACCAGCAGGGGGATGG + Intronic
973728281 4:53797682-53797704 CCTGCTCACCATCTGGTGGCTGG + Intronic
981529336 4:145736519-145736541 CCTGCTCCACAGCTGATGGACGG - Intronic
986831809 5:11588836-11588858 CCTGCTCCACAGCCTGGGGAAGG - Intronic
987403511 5:17502160-17502182 CTTGCGCACCAGGCGCTGGAAGG + Intergenic
987410988 5:17614900-17614922 CTTGCGCACCAGGCGCTGGAAGG + Intergenic
989286309 5:39703773-39703795 CCTGCTCACCATTTGGTGTAGGG + Intergenic
999204294 5:149837043-149837065 CCTGGTCACCAGCCACTCGAAGG + Exonic
999740412 5:154545748-154545770 CCTGGGCACCAGCCTGGGGAGGG - Intergenic
1002098684 5:176846745-176846767 CCTGGTCCACAGCCGGTGGTGGG + Intronic
1004291382 6:14370474-14370496 ACTGCACTCCAGCTGGTGGATGG + Intergenic
1006981196 6:38149658-38149680 GCTGCTCACTAGCTGGCGGAAGG + Intronic
1007398463 6:41590334-41590356 CCTGCTCACCTGGCGGATGAGGG - Exonic
1007736829 6:43987189-43987211 CTTGCTCAAGAGCCCGTGGAGGG + Intergenic
1008099688 6:47377534-47377556 CCTGCAGACCAGCAGATGGATGG - Intergenic
1019442916 7:1056431-1056453 CCTGCCCACCAGCCTCTGGATGG + Intronic
1022023251 7:26421799-26421821 CCTACTCATCATCCGGGGGATGG - Intergenic
1025955173 7:66177225-66177247 CATCCTCACCAGCAGATGGATGG + Intergenic
1026878668 7:73894375-73894397 CCCTCTCTCCAGCCGGTGGCTGG - Intergenic
1029458558 7:100683003-100683025 CCTGCTCACCACTCGGTGGTTGG + Exonic
1029743233 7:102503062-102503084 CCTGCTCACCATCCGCTGGTGGG - Intronic
1029761222 7:102602223-102602245 CCTGCTCACCATCCGCTGGTGGG - Intronic
1030365155 7:108637393-108637415 ACTTCTCTCCAGCAGGTGGATGG + Intergenic
1032492435 7:132333569-132333591 CCTGCTCCTCAGCTGCTGGAGGG + Intronic
1038892754 8:31745201-31745223 CCTGCTGAGTAGCTGGTGGAAGG + Intronic
1040781511 8:51115297-51115319 CCGGCTCACCAGACTGGGGAAGG - Intergenic
1041871120 8:62635422-62635444 CGAGGTCACCAGCTGGTGGAAGG - Intronic
1048486008 8:134848095-134848117 CCTGCACTCCAGCCTGTGGATGG - Intergenic
1049375977 8:142289405-142289427 CCTGCTCCCCAGCCTGAGGCTGG + Intronic
1049682535 8:143926078-143926100 TGTGCTCACCAGCCTGGGGAAGG + Intronic
1049932487 9:470333-470355 CCTGCTCAGCAGCGAGTGGTTGG + Intronic
1054676438 9:67859381-67859403 CCCGCTCAAGAGCCGGTGGTTGG + Exonic
1057564979 9:96159770-96159792 CCTCATCACCAGCCACTGGATGG + Intergenic
1060822761 9:126671138-126671160 CCAGCTCACCAGCCGTTGGCAGG + Intronic
1061539184 9:131268396-131268418 CCTGCTCACCAGCTGAGGGAGGG + Intronic
1061675507 9:132213434-132213456 TCTCCTCCCCAGCCGGTGGGTGG - Intronic
1062230220 9:135478370-135478392 CCCGCTCACCAGTGGGTGGACGG + Intergenic
1185617401 X:1431852-1431874 CGTGCTCACCAATCTGTGGACGG + Intronic
1192286785 X:69746779-69746801 TCTCCTCACCATCCGGAGGATGG - Intronic
1196420458 X:115515522-115515544 CCTTCTCACCAGCAGGTGGATGG + Intergenic
1198097102 X:133390854-133390876 GCTGCTGACCAGCTGGGGGATGG - Intronic
1200052937 X:153444413-153444435 CCTGCTCAGCAGGGGGTCGAGGG + Intergenic
1200071430 X:153531268-153531290 CCTGCTCCCCAGCTGGTCTAGGG + Intronic
1200084334 X:153595960-153595982 CCTGATCTCCACCCGGTGGGGGG - Intronic