ID: 1152345433

View in Genome Browser
Species Human (GRCh38)
Location 17:79748164-79748186
Sequence TAGCGGGTAGGGCGGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152345425_1152345433 -8 Left 1152345425 17:79748149-79748171 CCTCGGGGTGGGCCGTAGCGGGT No data
Right 1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG No data
1152345413_1152345433 24 Left 1152345413 17:79748117-79748139 CCGACGCGGGTGAACAAGCGATG No data
Right 1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG No data
1152345412_1152345433 25 Left 1152345412 17:79748116-79748138 CCCGACGCGGGTGAACAAGCGAT No data
Right 1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG No data
1152345423_1152345433 -7 Left 1152345423 17:79748148-79748170 CCCTCGGGGTGGGCCGTAGCGGG No data
Right 1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG No data
1152345411_1152345433 26 Left 1152345411 17:79748115-79748137 CCCCGACGCGGGTGAACAAGCGA No data
Right 1152345433 17:79748164-79748186 TAGCGGGTAGGGCGGGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152345433 Original CRISPR TAGCGGGTAGGGCGGGCGGC GGG Intergenic
No off target data available for this crispr