ID: 1152345437

View in Genome Browser
Species Human (GRCh38)
Location 17:79748177-79748199
Sequence GGGCGGCGGGGGTCGCACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152345431_1152345437 -7 Left 1152345431 17:79748161-79748183 CCGTAGCGGGTAGGGCGGGCGGC No data
Right 1152345437 17:79748177-79748199 GGGCGGCGGGGGTCGCACCCGGG No data
1152345425_1152345437 5 Left 1152345425 17:79748149-79748171 CCTCGGGGTGGGCCGTAGCGGGT No data
Right 1152345437 17:79748177-79748199 GGGCGGCGGGGGTCGCACCCGGG No data
1152345423_1152345437 6 Left 1152345423 17:79748148-79748170 CCCTCGGGGTGGGCCGTAGCGGG No data
Right 1152345437 17:79748177-79748199 GGGCGGCGGGGGTCGCACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152345437 Original CRISPR GGGCGGCGGGGGTCGCACCC GGG Intergenic
No off target data available for this crispr