ID: 1152347552

View in Genome Browser
Species Human (GRCh38)
Location 17:79762501-79762523
Sequence ACTCCACGTGGGGCATCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152347544_1152347552 -5 Left 1152347544 17:79762483-79762505 CCTGGCCAACCCCATTGCACTCC No data
Right 1152347552 17:79762501-79762523 ACTCCACGTGGGGCATCCGCTGG No data
1152347539_1152347552 29 Left 1152347539 17:79762449-79762471 CCCAAAGGGACCGAGTTGGCAAC No data
Right 1152347552 17:79762501-79762523 ACTCCACGTGGGGCATCCGCTGG No data
1152347540_1152347552 28 Left 1152347540 17:79762450-79762472 CCAAAGGGACCGAGTTGGCAACA No data
Right 1152347552 17:79762501-79762523 ACTCCACGTGGGGCATCCGCTGG No data
1152347542_1152347552 19 Left 1152347542 17:79762459-79762481 CCGAGTTGGCAACAGCAGGCAGT No data
Right 1152347552 17:79762501-79762523 ACTCCACGTGGGGCATCCGCTGG No data
1152347545_1152347552 -10 Left 1152347545 17:79762488-79762510 CCAACCCCATTGCACTCCACGTG No data
Right 1152347552 17:79762501-79762523 ACTCCACGTGGGGCATCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152347552 Original CRISPR ACTCCACGTGGGGCATCCGC TGG Intergenic
No off target data available for this crispr