ID: 1152349795

View in Genome Browser
Species Human (GRCh38)
Location 17:79778183-79778205
Sequence TCCGGGCGGGTGACTGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152349781_1152349795 24 Left 1152349781 17:79778136-79778158 CCGGGCGGGGGCGGTGCTTTGTG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1152349795 17:79778183-79778205 TCCGGGCGGGTGACTGGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 130
1152349780_1152349795 30 Left 1152349780 17:79778130-79778152 CCGGCGCCGGGCGGGGGCGGTGC 0: 1
1: 0
2: 8
3: 65
4: 446
Right 1152349795 17:79778183-79778205 TCCGGGCGGGTGACTGGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 130
1152349788_1152349795 -4 Left 1152349788 17:79778164-79778186 CCGGCGGGGCGCGCGGCGGTCCG 0: 1
1: 1
2: 2
3: 16
4: 174
Right 1152349795 17:79778183-79778205 TCCGGGCGGGTGACTGGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152349795 Original CRISPR TCCGGGCGGGTGACTGGCGG CGG Exonic
900349573 1:2228231-2228253 GCCGGGCGGGCGCCTCGCGGTGG + Intergenic
901022138 1:6260920-6260942 GCCGCGGGGGTGGCTGGCGGCGG + Exonic
901455321 1:9359845-9359867 GCCGGGGGGGTGGGTGGCGGGGG + Intronic
903857581 1:26345893-26345915 CCTGGGCAGGTGACTGGCAGGGG + Exonic
903935314 1:26891084-26891106 TGCTGGTGGGTGGCTGGCGGCGG + Exonic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
905617219 1:39409290-39409312 TGCGGGCCGGGGACTGGCGGCGG + Intronic
906114817 1:43349371-43349393 GCCAGGCAGGAGACTGGCGGTGG + Intronic
909358191 1:74732580-74732602 ATCAAGCGGGTGACTGGCGGGGG + Intronic
912371490 1:109177339-109177361 ACCGGGCGGCTGCCGGGCGGAGG + Intronic
914702822 1:150149950-150149972 GCCGGGCGGGCGGGTGGCGGGGG + Intronic
915208386 1:154287673-154287695 ACCGGGCGGCTGCCGGGCGGAGG - Intergenic
916864134 1:168837469-168837491 TCGGGGCGGCTGCCCGGCGGAGG - Intergenic
1065377862 10:25061120-25061142 ACAGAGCGGGTGACTGGAGGTGG - Intronic
1071538312 10:86454949-86454971 ACCGGGCGGCTGCCGGGCGGAGG - Intronic
1075940764 10:126388587-126388609 TCGGGGCGGGACCCTGGCGGGGG - Intergenic
1077485237 11:2835449-2835471 GCCGGTAGGGTGACTGGCCGAGG - Intronic
1078514279 11:12009154-12009176 TCGGGGTGGGTGAGGGGCGGCGG - Intronic
1085051768 11:73383689-73383711 TCAGGGGAGGTCACTGGCGGGGG - Intronic
1089993450 11:122882964-122882986 GCCGGGCAGGTGACGGGCGGTGG + Exonic
1092630222 12:10368633-10368655 TCTGGGCCGGTGACTGCCTGGGG + Intergenic
1095998069 12:48106014-48106036 TCCGGTTCGGTGAGTGGCGGCGG - Exonic
1096660817 12:53122998-53123020 GCCGGGCGGGGGGCTGGAGGTGG + Intronic
1096837384 12:54359401-54359423 CCCGGGCGGGCGACTGGGGAGGG + Intergenic
1102278341 12:111599338-111599360 GCCGGGCGGGGGAGGGGCGGCGG + Exonic
1103561129 12:121793741-121793763 GCCGGGAGGCTGCCTGGCGGAGG - Exonic
1106549652 13:30760264-30760286 GGAGGGGGGGTGACTGGCGGGGG + Intronic
1108577781 13:51804172-51804194 TCAGGGCGGGCGACTCCCGGGGG - Intergenic
1108610515 13:52080053-52080075 ACCGGGCGGCTGCCGGGCGGAGG - Intronic
1108648186 13:52450688-52450710 TCGGGGCGGGTGAGGGACGGAGG + Intergenic
1118930365 14:70234867-70234889 CCAGGGAGGGTGACAGGCGGGGG - Intergenic
1120505812 14:85352813-85352835 ACGGGGCGGCTGCCTGGCGGAGG + Intergenic
1125079161 15:35656022-35656044 ACGGGGCGGCTGCCTGGCGGAGG - Intergenic
1128970189 15:72100883-72100905 ACCGGGCGGCTGGCCGGCGGGGG - Intronic
1129423905 15:75451378-75451400 GCCGGGCGGGAGCCTGGTGGCGG - Intronic
1130002646 15:80060167-80060189 TGCGAGCGGTTGGCTGGCGGGGG + Intronic
1132551384 16:555217-555239 TCCGGGCGGGCCTCGGGCGGCGG + Intergenic
1135382827 16:22008428-22008450 GCCGGGCGGGGGATTGGCTGAGG + Intronic
1136583579 16:31169515-31169537 ACGGGGCGGTTGCCTGGCGGAGG - Intergenic
1140994327 16:80243863-80243885 TCCGGGAGGGAGACGGGTGGGGG + Intergenic
1142591166 17:1006738-1006760 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591186 17:1006803-1006825 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591206 17:1006868-1006890 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591226 17:1006933-1006955 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591246 17:1006998-1007020 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591266 17:1007063-1007085 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1142591286 17:1007128-1007150 CCCGGGCCCGTGGCTGGCGGAGG - Intronic
1143099672 17:4498421-4498443 TCCGGGCGTGTGAGTATCGGAGG + Intergenic
1143719462 17:8799414-8799436 TCCGGGCAGGTGGCCCGCGGAGG - Intergenic
1145087052 17:19951062-19951084 ACCGGGCGGCTGCCGGGCGGAGG - Intronic
1146332267 17:31937206-31937228 GCCCGGCGGGTAGCTGGCGGGGG + Exonic
1146913844 17:36665474-36665496 TCTGGGCTGCTGCCTGGCGGGGG - Intergenic
1147774142 17:42888703-42888725 TCAGCGCTGGTGACTGGGGGTGG + Intergenic
1147806985 17:43138823-43138845 CCCAGGCTGGTGACTGGTGGGGG - Intergenic
1147921413 17:43919400-43919422 CCCAGGCTGGTGACTGGTGGGGG - Intergenic
1148168936 17:45503427-45503449 CCCAGGCTGGTGACTGGTGGGGG - Intergenic
1148279881 17:46339586-46339608 CCCAGGCTGGTGACTGGTGGGGG + Exonic
1148302099 17:46557442-46557464 CCCAGGCTGGTGACTGGTGGGGG + Exonic
1148366580 17:47059959-47059981 CCCAGGCTGGTGACTGGTGGGGG + Intergenic
1149597889 17:57874842-57874864 TTCGGGCGGGTGGCCGGCGGCGG + Intronic
1150400131 17:64849888-64849910 CCCAGGCTGGTGACTGGTGGGGG - Intergenic
1151314048 17:73311200-73311222 GCGGGGCGGGAGCCTGGCGGGGG + Intronic
1151537756 17:74748506-74748528 TCCGGCCGGGTGAACGGCGCCGG - Intergenic
1152349795 17:79778183-79778205 TCCGGGCGGGTGACTGGCGGCGG + Exonic
1153739238 18:8105782-8105804 TTCTGGGGGGTGACTGGCAGTGG - Intronic
1160613611 18:80108179-80108201 TCAGGGCTGGAGGCTGGCGGCGG + Intergenic
1161857192 19:6772746-6772768 TGCGGGCGGGTGGGTGGTGGAGG + Exonic
1162444244 19:10712651-10712673 TCAGGGCGGGAGACGGGTGGGGG + Intronic
1162568657 19:11458101-11458123 GCCGGGCGGATGACTGGTAGAGG + Exonic
1163621880 19:18365828-18365850 TGCTGGCGGGTGACTTGCAGTGG + Exonic
1163686926 19:18717139-18717161 CCCTGGTGGGTGACTGGCGCTGG + Intronic
1163779924 19:19240677-19240699 ACCGGGCTGGTGAGTGGCAGGGG + Exonic
1164054098 19:21607256-21607278 ACCGGGCGGCTGCCAGGCGGAGG + Intergenic
1166721801 19:45001424-45001446 GCCGGGCGGGCGGCGGGCGGGGG - Exonic
1167056385 19:47113477-47113499 TCCGGGTGGGTGGCAGGAGGTGG + Intronic
1167072956 19:47231157-47231179 TGCGAGCGGGCGCCTGGCGGCGG - Intronic
1168658294 19:58147304-58147326 ACGGGGCGGCTGCCTGGCGGAGG - Intronic
925029323 2:636996-637018 TCCGGGCAGGTGGCTGAGGGTGG - Intergenic
931309691 2:61066216-61066238 ACCGGGCGGGTGACGGGACGCGG - Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
936585818 2:113756686-113756708 TCCGGGCTGGGGACTGGGGGCGG - Exonic
937950838 2:127387344-127387366 GCCGGGAGGGGGGCTGGCGGCGG - Intronic
938102265 2:128505164-128505186 CCCAGGGGGGTGACTGGAGGGGG - Intergenic
938970215 2:136424690-136424712 CCCGGGCTGGGGACTGGCAGGGG + Intergenic
941603191 2:167564105-167564127 ACGGGGCGGCTGCCTGGCGGAGG + Intergenic
948207315 2:236168897-236168919 ACCCGGCGGGTTTCTGGCGGCGG - Intergenic
948615842 2:239198310-239198332 TCATGGAGGGTGACTGGAGGTGG + Intronic
1169048775 20:2558981-2559003 TCCGCGCGGGGGAGTGGCCGCGG + Intronic
1169265398 20:4164257-4164279 TCGGGCCGGGTGACAGGCAGGGG - Intronic
1172722903 20:37012928-37012950 ACGGGGCGGCTGGCTGGCGGGGG - Intronic
1173734313 20:45348492-45348514 TCCGGGCGGGGTGCGGGCGGCGG - Intergenic
1179783839 21:43718960-43718982 TTCGGGCGGCAGAGTGGCGGGGG + Intergenic
1179912176 21:44456172-44456194 GCCGGGCGGCGGAGTGGCGGCGG - Intronic
1180649900 22:17369343-17369365 TCCGGGCGGGGGTGGGGCGGGGG + Intronic
1181639873 22:24190832-24190854 TCCTGGAGGGAGACTGGTGGGGG - Intergenic
1182355267 22:29719955-29719977 GGCGGGCGGGCGGCTGGCGGGGG + Intergenic
1183617218 22:38953267-38953289 TCCGGGCCAGTGACAGCCGGGGG - Intronic
1184225796 22:43128262-43128284 GGCGGGCGGCTGGCTGGCGGAGG + Intronic
949427518 3:3935354-3935376 GCCGGGTGGGGGACTGGGGGAGG - Intronic
953031732 3:39184217-39184239 TCTGGGCAGGGGACTGGCTGAGG + Exonic
954176134 3:48847391-48847413 TCCGGGCCGGGTTCTGGCGGGGG + Exonic
954356277 3:50085091-50085113 ACGGGGCGGCTGCCTGGCGGAGG + Intronic
968066472 3:195762115-195762137 CTCGGGCGGGAGGCTGGCGGAGG + Exonic
968674894 4:1871824-1871846 TCCGGGCAGGGGAGGGGCGGCGG + Intronic
968746838 4:2364791-2364813 TCCGAGCGGGTGACTGGGAATGG + Intronic
973650449 4:52992781-52992803 ACGGGGCGGCTGCCTGGCGGAGG - Intronic
983624811 4:169791736-169791758 GGCGGGCGGCTGTCTGGCGGCGG + Intergenic
985493771 5:193396-193418 TGCTGGGGGGTGCCTGGCGGTGG + Intronic
987313098 5:16699371-16699393 TCCGGGCTGATGGATGGCGGTGG - Intronic
997585224 5:135039795-135039817 TCCCCGCGGGCGACGGGCGGCGG - Intronic
1001445606 5:171780355-171780377 TGTGGGCGGGGGACTGGCAGAGG - Intergenic
1002296149 5:178232466-178232488 CCCGGGCGGGGGGCGGGCGGCGG - Intronic
1006871720 6:37257798-37257820 TGGGAGCGGGTGACCGGCGGCGG + Exonic
1007072703 6:39048758-39048780 CCCGGGCTGGTGGCGGGCGGTGG - Intergenic
1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG + Intergenic
1013304897 6:108838706-108838728 TCTGGGGAGGTGACTGGCGGTGG + Intergenic
1014110916 6:117617681-117617703 TCTGGGCTGGTGACTGCCCGGGG + Intergenic
1014913378 6:127118844-127118866 TCCGGGCGGGCGAGCGGCGGCGG - Exonic
1018905472 6:168073187-168073209 TGCAGGGGGGTGACTGGGGGTGG - Intronic
1025979245 7:66393655-66393677 TCCGGGAGGGAGGCGGGCGGGGG - Intronic
1029437756 7:100572493-100572515 CCCGGGAGGGTGATGGGCGGGGG + Exonic
1029640574 7:101816854-101816876 CCCGGGCCGGTGACAGCCGGGGG - Intronic
1031759150 7:125689211-125689233 TCAGGGCGGGTGGCAGGGGGAGG - Intergenic
1036755189 8:11466801-11466823 TCAGGGCGGTTGCCTGGCGACGG + Intronic
1038404542 8:27311502-27311524 TCCGGGCGGGTCCCTGGCCGGGG + Exonic
1038562373 8:28591366-28591388 GCGGGGCAGGTGACTGGGGGTGG + Intergenic
1042912832 8:73844900-73844922 ACCGGGCGGCTGCCGGGCGGAGG - Intronic
1047499179 8:125429400-125429422 TCCGGGCGGGCGGCAGGCGCGGG + Intergenic
1049680313 8:143915249-143915271 CCCGGGCGGGTGGCAGGTGGAGG - Exonic
1049684450 8:143933728-143933750 TCGGGGAGGGGGCCTGGCGGGGG + Intronic
1053312374 9:37027729-37027751 TCCGGGCGGGGGCGGGGCGGGGG + Intronic
1054738466 9:68780209-68780231 TACGGGCGGGAGCCCGGCGGAGG + Exonic
1059432613 9:114259136-114259158 TCCTGGCAGGGGACTGGCAGGGG + Intronic
1062349899 9:136133457-136133479 TCCGGGCGCGGGGCTGGGGGCGG - Intergenic
1062391272 9:136334868-136334890 TGCTGGCGGGTGAGTGGGGGTGG + Intronic
1062428128 9:136515453-136515475 GCCAGGCGGGTGGCCGGCGGGGG - Intronic
1062611052 9:137373576-137373598 TCCGGGAGGAAGCCTGGCGGGGG - Exonic
1203760505 EBV:10784-10806 CACGGCCGGGTGACTGGTGGGGG - Intergenic
1185890003 X:3815116-3815138 CCGGGGCGGGTCAATGGCGGTGG + Intergenic