ID: 1152349884

View in Genome Browser
Species Human (GRCh38)
Location 17:79778496-79778518
Sequence GGCCGCGCCGTCCGGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152349866_1152349884 16 Left 1152349866 17:79778457-79778479 CCCGCCCCCTCGCCCGGGGGTGG 0: 1
1: 0
2: 2
3: 37
4: 293
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349856_1152349884 28 Left 1152349856 17:79778445-79778467 CCGCGCCCCCCTCCCGCCCCCTC 0: 1
1: 1
2: 54
3: 686
4: 6086
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349873_1152349884 10 Left 1152349873 17:79778463-79778485 CCCTCGCCCGGGGGTGGGGACGT 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349874_1152349884 9 Left 1152349874 17:79778464-79778486 CCTCGCCCGGGGGTGGGGACGTG 0: 1
1: 0
2: 2
3: 11
4: 189
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349876_1152349884 4 Left 1152349876 17:79778469-79778491 CCCGGGGGTGGGGACGTGGAGCC 0: 1
1: 0
2: 4
3: 48
4: 364
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349857_1152349884 23 Left 1152349857 17:79778450-79778472 CCCCCCTCCCGCCCCCTCGCCCG 0: 1
1: 0
2: 13
3: 236
4: 2687
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349864_1152349884 19 Left 1152349864 17:79778454-79778476 CCTCCCGCCCCCTCGCCCGGGGG 0: 1
1: 0
2: 2
3: 72
4: 545
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349877_1152349884 3 Left 1152349877 17:79778470-79778492 CCGGGGGTGGGGACGTGGAGCCC 0: 1
1: 0
2: 3
3: 44
4: 368
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349872_1152349884 11 Left 1152349872 17:79778462-79778484 CCCCTCGCCCGGGGGTGGGGACG 0: 1
1: 0
2: 2
3: 6
4: 158
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349868_1152349884 15 Left 1152349868 17:79778458-79778480 CCGCCCCCTCGCCCGGGGGTGGG 0: 1
1: 0
2: 4
3: 28
4: 351
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349860_1152349884 21 Left 1152349860 17:79778452-79778474 CCCCTCCCGCCCCCTCGCCCGGG 0: 1
1: 0
2: 4
3: 103
4: 875
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349858_1152349884 22 Left 1152349858 17:79778451-79778473 CCCCCTCCCGCCCCCTCGCCCGG 0: 1
1: 0
2: 7
3: 144
4: 1437
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349871_1152349884 12 Left 1152349871 17:79778461-79778483 CCCCCTCGCCCGGGGGTGGGGAC 0: 1
1: 1
2: 1
3: 23
4: 206
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349862_1152349884 20 Left 1152349862 17:79778453-79778475 CCCTCCCGCCCCCTCGCCCGGGG 0: 1
1: 0
2: 2
3: 54
4: 513
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152349884 Original CRISPR GGCCGCGCCGTCCGGTGGCC TGG Intronic
900020939 1:186425-186447 GGTCGACCCCTCCGGTGGCCGGG - Intergenic
900210446 1:1453087-1453109 TGCAGCGCCTGCCGGTGGCCTGG + Intronic
900223421 1:1521581-1521603 TGCAGCGCCTGCCGGTGGCCTGG + Intronic
900959830 1:5911853-5911875 GGCCGCGCTGTCCTCTGGGCAGG - Intronic
903154787 1:21436207-21436229 CGCCACGCCTTTCGGTGGCCTGG + Intergenic
903398350 1:23019797-23019819 GGCCTCGCCCCCCGGGGGCCTGG + Exonic
903413774 1:23168103-23168125 GGCCGCGCCGGCCCGCGTCCCGG - Intronic
903860112 1:26360025-26360047 GGCCGAGCGGTGCGGAGGCCCGG - Intergenic
904003211 1:27350100-27350122 GGCGGCGCCGGGCGGCGGCCAGG - Exonic
905179263 1:36156354-36156376 GGCGGCGGCGGCCAGTGGCCAGG - Exonic
919741625 1:200984586-200984608 GGCCGGGCAGTCAGGTGGGCTGG - Intronic
921432776 1:215082953-215082975 CGCCGCGCCGTGCCGGGGCCGGG + Intronic
922526595 1:226309011-226309033 GGCCGTGCCCTCCGCTGGGCAGG - Intronic
1067370636 10:45678678-45678700 GGCCGCGCTGTGAGGTGGGCAGG + Intergenic
1067389139 10:45847465-45847487 GGCCGCGCTGTGAGGTGGGCAGG - Exonic
1067502335 10:46816376-46816398 GGCCGCGCTGTGAGGTGGGCAGG + Intergenic
1070136361 10:73697873-73697895 GGCCGCGCTGTGAGGTGGGCAGG - Exonic
1072454216 10:95561670-95561692 GGCCGGGCCGGACGCTGGCCTGG + Intergenic
1073135443 10:101217678-101217700 GGCCGCGCCGTCTGGACCCCAGG + Intergenic
1074772253 10:116742018-116742040 GGGCCCGCCGCCGGGTGGCCGGG - Intronic
1074867715 10:117554452-117554474 GGCCTCGCCTGGCGGTGGCCTGG + Intergenic
1075401408 10:122163826-122163848 GGGCGAGCCGGCCGGCGGCCGGG - Intronic
1075800773 10:125152109-125152131 GGCCGCGCCGCCAGGTGTTCTGG + Intronic
1077043924 11:536035-536057 GGCCGCGGGGTCCGGTTGCCCGG + Intronic
1077253813 11:1571962-1571984 GGCCGCGCCGTCCATGGGCCCGG + Intergenic
1083448492 11:62726943-62726965 GGCCGCGTCGGGCGGCGGCCCGG - Exonic
1083571246 11:63763280-63763302 GGCCGCGCCCCCCGCTGGCCGGG - Exonic
1083970407 11:66070735-66070757 CTCCGCGCCTCCCGGTGGCCCGG + Exonic
1085647418 11:78235013-78235035 GGCAGCCCCTCCCGGTGGCCCGG - Intronic
1088641654 11:111878912-111878934 GGACGCGCCGGCCGCTGGGCGGG + Intronic
1089627218 11:119759034-119759056 GACCCCACTGTCCGGTGGCCTGG - Intergenic
1097236930 12:57546830-57546852 TGGTGCGCCGTCCGGCGGCCCGG + Intronic
1102197132 12:111033923-111033945 GCCCGCGCCCTCCGGGGGTCGGG + Intergenic
1106602471 13:31199911-31199933 GGCCGCGCCCTCTGGCGGCCGGG - Intergenic
1113656120 13:112068570-112068592 GGCCGCGTCGTCGGGCGCCCTGG + Exonic
1117131820 14:52695147-52695169 CGCCGCGCCCTCCGGTGCCTCGG - Intronic
1121312305 14:92941758-92941780 GGCCGAGCCGGCGGGCGGCCTGG - Exonic
1121453990 14:94026928-94026950 GGCCGAGCCGTCGGGTGGGTGGG - Intronic
1124469354 15:29969044-29969066 GGCGGCGCGCTCCGGTGGGCGGG + Intergenic
1128489870 15:68134934-68134956 GGCCGCCCCGTCCGGGGGGTGGG - Intronic
1129332417 15:74834477-74834499 GGCAGCGCAGTCCGGAGGCTGGG - Intergenic
1132996656 16:2827075-2827097 GGCGGGGCCTTCCTGTGGCCTGG - Intergenic
1134201453 16:12202977-12202999 GGCCCCGCTGTCAGGTGGACTGG + Intronic
1134245141 16:12534138-12534160 GGCCGCGCTGCCCTGAGGCCTGG - Intronic
1136462037 16:30417569-30417591 GCCCGCGCCGTCCGCCGACCCGG + Exonic
1137396558 16:48119586-48119608 GGCCATGCCGTCCTGTGGCCAGG - Intronic
1138598449 16:58041685-58041707 GGCCGGGGCGGCCGGTGGTCAGG - Exonic
1142136335 16:88453518-88453540 GGCCGCGGAGACCGGGGGCCGGG + Exonic
1142206312 16:88784818-88784840 GCCGGCGTCGTCCGGTGTCCAGG + Intronic
1142836817 17:2593677-2593699 GGCGGCGGAGTCCGGCGGCCGGG + Intronic
1143119863 17:4599903-4599925 GGCCCCGCCTCCCGGTGGCCTGG + Intronic
1145963799 17:28902851-28902873 GGCCCCGCCGTGCGGCGGCATGG - Exonic
1147686283 17:42288569-42288591 GGCCGCACCGTCCGGCAGCCGGG - Exonic
1147786021 17:42979522-42979544 GGCCCTGCCGTCCGAGGGCCTGG - Intronic
1147971015 17:44219175-44219197 CGCCGCCCCCTCCGGCGGCCGGG + Intronic
1152072529 17:78140981-78141003 GGCCGCGGGGCCTGGTGGCCCGG - Exonic
1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG + Intronic
1154241506 18:12657768-12657790 GGCCGCGCCGCCGGCTGCCCCGG + Exonic
1157338165 18:46756509-46756531 GCCCGCGGCGCCCGGTAGCCAGG - Exonic
1159578276 18:70206008-70206030 CGCCGCGGCGCCCGCTGGCCTGG + Intergenic
1160765357 19:805235-805257 GGCCGCTCAGTCCGGAGCCCCGG + Intronic
1161483751 19:4523875-4523897 GGCCGCGCTGGCCGAGGGCCGGG - Exonic
1162024916 19:7888446-7888468 GGCCGAGTCGTCCGGGGGCGGGG + Intergenic
1162907071 19:13830459-13830481 GGACGCGGCGGCCGGCGGCCTGG + Exonic
1166679413 19:44757942-44757964 GGCCCCGCCCTGCGATGGCCTGG + Intronic
925079991 2:1056278-1056300 GGCCGCGCCGTGCTGTGGGGAGG + Intronic
925080003 2:1056313-1056335 GGCCGCGCCGTGCTGTGGGGAGG + Intronic
927714007 2:25341349-25341371 GTCCGCGCCCTCCGGCGCCCTGG + Intronic
928002873 2:27539754-27539776 AGCCGCCCCGTCCGGGGGCGGGG - Intronic
928093760 2:28392132-28392154 GCCCGCGCCGCCCTGCGGCCGGG - Intergenic
930034360 2:47076278-47076300 TGCCGCGCCTCCCGGCGGCCTGG + Intronic
932607756 2:73176098-73176120 CGCCGCGCCGTCTTGAGGCCTGG + Intergenic
936568499 2:113597508-113597530 GGTCGACCCCTCCGGTGGCCGGG + Intergenic
946003071 2:216499084-216499106 GGCCGCGCGCTCCGAAGGCCCGG - Intronic
946921300 2:224584779-224584801 CCCCGCGCCGCCCGGTTGCCGGG + Intronic
948100416 2:235368497-235368519 GGCCTCGCCGTCTAGTGGCTAGG - Intergenic
948459788 2:238123604-238123626 GGCCGAGGTGTCAGGTGGCCAGG - Intronic
1169065642 20:2693014-2693036 GGCGGCGGCGTCTGCTGGCCCGG + Exonic
1169483511 20:6006476-6006498 GCCCGCTCCGGCCGCTGGCCTGG - Exonic
1170578617 20:17681967-17681989 GGCCGGGCCGTCGGGGGGCCGGG - Intronic
1175252247 20:57616683-57616705 GGCTGCGCAGCCTGGTGGCCAGG + Intronic
1178843657 21:36157061-36157083 GGCGGCGCCGTGGGGCGGCCCGG + Intronic
1178916743 21:36709201-36709223 GGCGACGCCGTCCAGGGGCCCGG - Exonic
1180137536 21:45871215-45871237 GGCCGTGCAGTCCAGTGCCCGGG + Intronic
1180137551 21:45871261-45871283 GGCCGTGCAGTCCAGTGCCCGGG + Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1182485055 22:30634577-30634599 CGCTGCGCCCTCTGGTGGCCAGG - Intergenic
1183294104 22:37019686-37019708 GCCCGCGCCTTCCACTGGCCGGG - Intronic
1183548478 22:38467949-38467971 GGCCGCCCAGTCCGGGAGCCGGG + Intergenic
1184471144 22:44697195-44697217 GGCCACCAGGTCCGGTGGCCTGG + Intronic
1184601978 22:45549089-45549111 GGCCACGCCATCCCCTGGCCTGG - Intronic
1184781762 22:46653224-46653246 GGCCGTGCCGCCCGCTGCCCCGG + Intronic
953404823 3:42654960-42654982 GGCGGCGCCGTCCGGGCGCAGGG - Intronic
954618604 3:51983293-51983315 GGCCGCGGCGGCCGCTGCCCGGG + Exonic
955768575 3:62369086-62369108 GGGCGCGCCCTCCGGCGGCAGGG + Intergenic
956892206 3:73624102-73624124 GGCCGCGCCGCCCGGCGGCAAGG - Exonic
960691322 3:120349244-120349266 CCACGCGCCGTGCGGTGGCCAGG - Exonic
968640667 4:1712829-1712851 GGCCGCGCCTTCCGGGTTCCGGG - Intergenic
968702647 4:2064180-2064202 GGCCGCGCCGGGCGGCGGGCAGG - Exonic
975118428 4:70704709-70704731 GGCCGCGCCGTCGGGCGGGGCGG + Intronic
975415337 4:74098893-74098915 GGCAGCGCAGTTCAGTGGCCAGG + Exonic
992105581 5:73447406-73447428 GGCCGCGCCGTGCGGTGGCGGGG + Exonic
992866334 5:80960555-80960577 GGCCGCGGCGCGCGGTGGCAGGG - Intergenic
995574451 5:113514196-113514218 GCCCGCCCCGGACGGTGGCCCGG - Intronic
997638800 5:135435160-135435182 GACAGCACCGTCCGCTGGCCAGG + Intergenic
1002091825 5:176810625-176810647 GGCAGCGCAGTCCGCTGGCATGG + Exonic
1003427728 6:6008745-6008767 GGGCTCGCCTTCCGGTGTCCAGG + Intergenic
1005644328 6:27826782-27826804 GGCCGCCCCGTCCGGGGGGGAGG - Intergenic
1014246827 6:119078540-119078562 GGCGGCGGCGGCCGGGGGCCGGG + Exonic
1019618305 7:1977163-1977185 GGCCGCGCCGTCGGGGAGGCTGG + Intronic
1020106955 7:5426655-5426677 GGCCGCCCCGCCTGGTGGCCAGG - Intergenic
1020274380 7:6615708-6615730 GGCCGGGCCGCGCGGGGGCCGGG - Exonic
1022183860 7:27948074-27948096 AGCAGCACCGTCCAGTGGCCTGG - Intronic
1023360919 7:39414483-39414505 GCCCTCGCCGTCCTGAGGCCTGG + Intronic
1029708131 7:102286223-102286245 GGCCGTCCCGCCCTGTGGCCCGG + Intronic
1038150905 8:24941997-24942019 CGCCCCGCCTCCCGGTGGCCTGG + Intergenic
1042956759 8:74259442-74259464 GGCCGCGCTGGCCGCTCGCCAGG - Exonic
1043372842 8:79613014-79613036 GGCCGCGCCTTTGTGTGGCCGGG - Intronic
1049093762 8:140535637-140535659 AGCCGCGCCGCCCGCTGGCCAGG + Intronic
1049166396 8:141128610-141128632 AGCCGCGCCGCCTGGGGGCCGGG - Exonic
1053372726 9:37576242-37576264 GGCCGCGGCCGCCGGTGCCCTGG + Exonic
1056643195 9:88388339-88388361 GGCCGCGCCGCCCCGGCGCCTGG - Intergenic
1061028981 9:128068354-128068376 GGCGGCGGCGTCCGGCGGCGGGG - Exonic
1061248425 9:129413388-129413410 GGCCGCGGCGGGCGGGGGCCGGG - Intergenic
1062047049 9:134429172-134429194 GGACGTGCAGCCCGGTGGCCAGG - Exonic
1062289091 9:135786595-135786617 GGCCACGGCGTCCCGGGGCCCGG + Intronic
1186496551 X:10015906-10015928 GGTGGCGCCGGCCGGCGGCCCGG - Intronic
1200277856 X:154751154-154751176 GGCCGCGGCGGCCGGAGGCGGGG - Intronic
1202109535 Y:21405938-21405960 GGCCGGGGCGTCCTGGGGCCAGG - Intergenic