ID: 1152349884

View in Genome Browser
Species Human (GRCh38)
Location 17:79778496-79778518
Sequence GGCCGCGCCGTCCGGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152349857_1152349884 23 Left 1152349857 17:79778450-79778472 CCCCCCTCCCGCCCCCTCGCCCG 0: 1
1: 0
2: 13
3: 236
4: 2687
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349871_1152349884 12 Left 1152349871 17:79778461-79778483 CCCCCTCGCCCGGGGGTGGGGAC 0: 1
1: 1
2: 1
3: 23
4: 206
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349872_1152349884 11 Left 1152349872 17:79778462-79778484 CCCCTCGCCCGGGGGTGGGGACG 0: 1
1: 0
2: 2
3: 6
4: 158
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349873_1152349884 10 Left 1152349873 17:79778463-79778485 CCCTCGCCCGGGGGTGGGGACGT 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349876_1152349884 4 Left 1152349876 17:79778469-79778491 CCCGGGGGTGGGGACGTGGAGCC 0: 1
1: 0
2: 4
3: 48
4: 364
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349862_1152349884 20 Left 1152349862 17:79778453-79778475 CCCTCCCGCCCCCTCGCCCGGGG 0: 1
1: 0
2: 2
3: 54
4: 513
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349856_1152349884 28 Left 1152349856 17:79778445-79778467 CCGCGCCCCCCTCCCGCCCCCTC 0: 1
1: 1
2: 54
3: 686
4: 6086
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349874_1152349884 9 Left 1152349874 17:79778464-79778486 CCTCGCCCGGGGGTGGGGACGTG 0: 1
1: 0
2: 2
3: 11
4: 189
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349877_1152349884 3 Left 1152349877 17:79778470-79778492 CCGGGGGTGGGGACGTGGAGCCC 0: 1
1: 0
2: 3
3: 44
4: 368
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349858_1152349884 22 Left 1152349858 17:79778451-79778473 CCCCCTCCCGCCCCCTCGCCCGG 0: 1
1: 0
2: 7
3: 144
4: 1437
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349866_1152349884 16 Left 1152349866 17:79778457-79778479 CCCGCCCCCTCGCCCGGGGGTGG 0: 1
1: 0
2: 2
3: 37
4: 293
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349868_1152349884 15 Left 1152349868 17:79778458-79778480 CCGCCCCCTCGCCCGGGGGTGGG 0: 1
1: 0
2: 4
3: 28
4: 351
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349864_1152349884 19 Left 1152349864 17:79778454-79778476 CCTCCCGCCCCCTCGCCCGGGGG 0: 1
1: 0
2: 2
3: 72
4: 545
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116
1152349860_1152349884 21 Left 1152349860 17:79778452-79778474 CCCCTCCCGCCCCCTCGCCCGGG 0: 1
1: 0
2: 4
3: 103
4: 875
Right 1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152349884 Original CRISPR GGCCGCGCCGTCCGGTGGCC TGG Intronic