ID: 1152350187

View in Genome Browser
Species Human (GRCh38)
Location 17:79779796-79779818
Sequence CAGGTTTGCCACAGTGACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152350182_1152350187 27 Left 1152350182 17:79779746-79779768 CCTTTTCTGCTGAGTAATTTGCA 0: 1
1: 0
2: 1
3: 52
4: 479
Right 1152350187 17:79779796-79779818 CAGGTTTGCCACAGTGACGCAGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152350187 Original CRISPR CAGGTTTGCCACAGTGACGC AGG Intronic
908508764 1:64833288-64833310 CAGGTTTGACACAGAGACCTTGG + Exonic
912305559 1:108562577-108562599 CAGGTTTACCACAGTGGAACTGG - Intronic
913474177 1:119220947-119220969 CAGTTTTGCCACACTGATGATGG - Intergenic
914195186 1:145444670-145444692 CAAGCTTGCCACAGTGGCGTAGG + Intergenic
914476457 1:148027246-148027268 CAAGCTTGCCACAGTGGCGTAGG + Intergenic
918901255 1:190422015-190422037 CAAGTTTCCCAGAGTGACACTGG + Intronic
920202609 1:204268950-204268972 GAGATTTTCCACAGTGATGCAGG - Intronic
1067742730 10:48908168-48908190 CAGGCTTGCTACAGTGACTGGGG - Intronic
1073111017 10:101063065-101063087 CGGGTGTGCCACAGTGAGGTTGG - Exonic
1074960939 10:118445258-118445280 CAGGTTTGCAACAATAAAGCAGG - Intergenic
1076429085 10:130389023-130389045 CAGGGATGTCACAGTGACTCGGG - Intergenic
1078328089 11:10396756-10396778 CAGGTCTGCCACTTTGAAGCTGG - Intronic
1080250998 11:30233704-30233726 CACACTTGCCACAGTGACACTGG - Exonic
1085277566 11:75309831-75309853 CAGCTGTGCCTCAGTGAGGCAGG + Intronic
1089669121 11:120040199-120040221 CAGGTGTGCAACAGAGAAGCTGG + Intergenic
1097758193 12:63429788-63429810 GAGGTTTGCCACCGTCACCCAGG - Intergenic
1098088400 12:66873372-66873394 AAAGTCTGCCACAGTGATGCTGG + Intergenic
1104966195 12:132509741-132509763 CGGGCTGGCCACAGTGACACGGG - Intronic
1107735622 13:43395843-43395865 GAGGTTTGCCAAGGTGATGCAGG + Intronic
1108371660 13:49775458-49775480 CTAGTTTGTCACAGTGACCCAGG - Intronic
1111773484 13:92628606-92628628 CAGTTTAGTCACAGTGATGCTGG - Intronic
1116641277 14:47466543-47466565 CAGCTTTGTCACAGAGAGGCTGG - Intronic
1122200792 14:100121357-100121379 CAGGTCTGTCACAGTTACCCTGG + Intronic
1127808894 15:62546102-62546124 CTGCTTTGACACAGTGAGGCTGG + Intronic
1131461916 15:92623483-92623505 CAGATTTCCCACCGTGCCGCAGG + Intronic
1134434826 16:14246927-14246949 CAGGTTTGACAGAGTGCTGCTGG - Exonic
1135990827 16:27217788-27217810 CAGGGTTGCCAGAGGGACACAGG - Intronic
1139397851 16:66654670-66654692 CAGCTCTGCCACTGTGACCCTGG + Intronic
1141181143 16:81754104-81754126 CAGGGTTGACCCAGTGACACAGG + Intronic
1141492433 16:84383185-84383207 CAGTTTTGGGACAGTGAGGCTGG - Intronic
1141948941 16:87328379-87328401 CAGGGATGCCACAGAGCCGCAGG + Exonic
1144309094 17:13996196-13996218 CTGGATTGCCACAGAGACACTGG + Intergenic
1145763907 17:27444848-27444870 CAGGTTTGCAACACTGAGGCTGG + Intergenic
1150493300 17:65589071-65589093 CAGGGTTCCCACAGTGAGGTGGG - Intronic
1151298189 17:73201290-73201312 CCGGTTTGCCACGCTGACCCAGG - Exonic
1151381055 17:73726056-73726078 CAGGTTTGTCACAGTTCAGCGGG - Intergenic
1152350187 17:79779796-79779818 CAGGTTTGCCACAGTGACGCAGG + Intronic
1160422589 18:78757288-78757310 CAGTTTAGCAACAGTGAGGCTGG - Intergenic
1163590718 19:18192837-18192859 CTGATTTGCCAGCGTGACGCCGG + Intergenic
1165392535 19:35546685-35546707 CAGGTCTGCCACATCCACGCTGG - Exonic
925336958 2:3105854-3105876 GGGGTTTGGCACAGAGACGCAGG - Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
928084738 2:28338990-28339012 CAGGTTGGTCACATTGACTCAGG - Intergenic
933852823 2:86384907-86384929 CAAGCTTGCCCCAGTGACCCAGG + Intergenic
940131461 2:150387618-150387640 CTGGTTAGCCAGAGTGATGCAGG + Intergenic
945501786 2:210584735-210584757 GAGGTTAGCCACAGAGACTCTGG - Intronic
1171486334 20:25489163-25489185 CAGGTGGTCCACAGTAACGCAGG - Intronic
1172308302 20:33897548-33897570 CAGCTCTGCCACAGTCAGGCTGG + Intergenic
1174570178 20:51495845-51495867 CAGGTTTCCCACAGGGACAGAGG - Intronic
1176013564 20:62914651-62914673 CAGGCTTGCCCCAGGGAGGCAGG + Intronic
949706793 3:6827673-6827695 CAGGGTAGCCACAGTGCCGTAGG - Intronic
954652819 3:52175718-52175740 CAGGTATTCCACAGTGACGTGGG + Intergenic
956170222 3:66427516-66427538 CAGGCTGGGCACAGTGACTCTGG + Intronic
961305978 3:125959312-125959334 CAGGCTGGCCACAGTGACACGGG - Intergenic
970946859 4:21704085-21704107 CAGCCTTTCAACAGTGACGCTGG + Intronic
977860342 4:101950714-101950736 CAGGTTTTCCACTGTGAAGGTGG - Intronic
981410201 4:144420798-144420820 TAGGTTTGCCAAACTAACGCAGG - Intergenic
983072966 4:163291728-163291750 CAGGTTTCCCTCTGTCACGCAGG - Intergenic
985069688 4:186156075-186156097 CATCTTTGACACAGTCACGCGGG - Exonic
985843735 5:2329240-2329262 CAGGTCAGCGACAGTGAGGCAGG + Intergenic
989454750 5:41630300-41630322 CAGTTTTGCCAAGGTGAGGCAGG + Intergenic
994671587 5:102767971-102767993 CAAGCTTGCCAGAGTGACACAGG - Intronic
995560914 5:113380859-113380881 CATGTTTGCCACAGTCACACTGG - Intronic
1007954492 6:45903992-45904014 CTGGTTTGCCACAGTCAGGGGGG + Intronic
1008273696 6:49519019-49519041 CAGATTTGCCCCAGTCACGCTGG + Intronic
1012977674 6:105797388-105797410 CAGGTTTGCCTGAGGGACACAGG + Intergenic
1013007524 6:106087814-106087836 CAGCTTTTCCACAGTGCCGAGGG + Intronic
1015085890 6:129291646-129291668 GAGGTTTGCCACAGTCAAACTGG + Exonic
1021791425 7:24209791-24209813 CAGGTTGGCCACAGAGACATTGG - Intergenic
1024185123 7:46941500-46941522 CAGGTTTTCCCCAGAAACGCTGG + Intergenic
1044849715 8:96416790-96416812 CAGGTTTCCTACAGTGACTTTGG - Intergenic
1045093844 8:98776332-98776354 CAGGTTTGCTGCAGGGAAGCTGG + Intronic
1045126961 8:99102784-99102806 AAGGCTTGCCAAAGTGACACAGG - Intronic
1046741047 8:117829416-117829438 CAACTTTGCCACATTGACGCTGG + Intronic
1047779453 8:128099415-128099437 CCGTTTTCCCACAGTGATGCTGG - Intergenic
1049183988 8:141239151-141239173 CATGTTTGCCGCAGTCACGTGGG - Intronic
1049496727 8:142939106-142939128 CAGGTCAGCCACAGTGACCAAGG + Intergenic
1051440161 9:17074951-17074973 CAGGCTGGCCACAGTGGCTCAGG + Intergenic
1185782472 X:2861519-2861541 CAGCTTTGCCACAGTGATGTGGG + Exonic
1188870456 X:35365027-35365049 CAGGTTAGCCATAGTGGTGCAGG - Intergenic
1194090144 X:89575465-89575487 CTGGTTGGCCAAAGTGGCGCAGG + Intergenic
1197049987 X:122046298-122046320 CTGGTTAGCCAGAGTGATGCAGG + Intergenic
1200442791 Y:3231518-3231540 CTGGTTGGCCAAAGTGGCGCAGG + Intergenic