ID: 1152351396

View in Genome Browser
Species Human (GRCh38)
Location 17:79785764-79785786
Sequence CCATAGCCCACAAGCCAGCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 95}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152351394_1152351396 -6 Left 1152351394 17:79785747-79785769 CCAGTTCAGGGCAGCATCCATAG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1152351396 17:79785764-79785786 CCATAGCCCACAAGCCAGCGTGG 0: 1
1: 0
2: 1
3: 4
4: 95
1152351387_1152351396 25 Left 1152351387 17:79785716-79785738 CCTAAAAGGCTGCCTTCATGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152351396 17:79785764-79785786 CCATAGCCCACAAGCCAGCGTGG 0: 1
1: 0
2: 1
3: 4
4: 95
1152351388_1152351396 13 Left 1152351388 17:79785728-79785750 CCTTCATGGCCATCTAGCCCCAG 0: 1
1: 0
2: 1
3: 22
4: 212
Right 1152351396 17:79785764-79785786 CCATAGCCCACAAGCCAGCGTGG 0: 1
1: 0
2: 1
3: 4
4: 95
1152351393_1152351396 -5 Left 1152351393 17:79785746-79785768 CCCAGTTCAGGGCAGCATCCATA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1152351396 17:79785764-79785786 CCATAGCCCACAAGCCAGCGTGG 0: 1
1: 0
2: 1
3: 4
4: 95
1152351386_1152351396 26 Left 1152351386 17:79785715-79785737 CCCTAAAAGGCTGCCTTCATGGC 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1152351396 17:79785764-79785786 CCATAGCCCACAAGCCAGCGTGG 0: 1
1: 0
2: 1
3: 4
4: 95
1152351391_1152351396 4 Left 1152351391 17:79785737-79785759 CCATCTAGCCCCAGTTCAGGGCA 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1152351396 17:79785764-79785786 CCATAGCCCACAAGCCAGCGTGG 0: 1
1: 0
2: 1
3: 4
4: 95
1152351392_1152351396 -4 Left 1152351392 17:79785745-79785767 CCCCAGTTCAGGGCAGCATCCAT 0: 1
1: 0
2: 0
3: 19
4: 198
Right 1152351396 17:79785764-79785786 CCATAGCCCACAAGCCAGCGTGG 0: 1
1: 0
2: 1
3: 4
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152351396 Original CRISPR CCATAGCCCACAAGCCAGCG TGG Exonic
900709068 1:4100956-4100978 CCTGCTCCCACAAGCCAGCGTGG - Intergenic
902706201 1:18206721-18206743 CCATGGCCCAGAAGCCTGTGCGG - Intronic
902899061 1:19501394-19501416 CCATTTCCCACTAGCCAGTGAGG + Intergenic
903070909 1:20726678-20726700 CCACGGCCCACCAGCCAGGGCGG + Intronic
913143555 1:115966405-115966427 CCATAGTCAACAAGCCAGCATGG + Intergenic
913533093 1:119747061-119747083 CCACAGCCCACACACCAGCTGGG - Intergenic
915322407 1:155063034-155063056 CCAGAGCCCAGGAGCCAGGGCGG + Intergenic
920999347 1:211026793-211026815 CCATCCCCCACAACCCAGAGAGG + Intronic
921901998 1:220461179-220461201 CCTTAGGCCTCAAGCCAGCTAGG + Intergenic
922898532 1:229119005-229119027 CCAGAGCTCACAAGGCAGCCAGG + Intergenic
923533709 1:234831738-234831760 CCATAAACCACAAGACAGAGAGG + Intergenic
923650171 1:235866637-235866659 CCAGAGCCCAGAAGCCAGAGAGG + Intronic
1070372165 10:75792660-75792682 TCAGAGCCCACCAGCCAGCCTGG + Intronic
1074868959 10:117562314-117562336 CGAAAGCCCACAGGCCAGCCTGG - Intergenic
1077478806 11:2803417-2803439 CCAGAGCCCAGAAGGCACCGTGG - Intronic
1079853145 11:25564050-25564072 CCATAGCACAAAAGCCAACAGGG - Intergenic
1084009198 11:66338353-66338375 CAACAGCCCACAAGCCACAGAGG - Intronic
1086742003 11:90379964-90379986 CCAAAGCCCACAAGCTAGAATGG + Intergenic
1102993320 12:117330237-117330259 TCATAGCCCAGAAGCCAACCTGG - Intronic
1103900895 12:124303218-124303240 CCATAGCCCACAGGCCGGCGAGG - Intronic
1108199186 13:48025816-48025838 CCATAGGCCACCAGCAAGCTGGG - Intergenic
1120072608 14:80120865-80120887 CCAGAGCCCTGAAGCCAGAGGGG - Intergenic
1125374391 15:39013364-39013386 CCATAGCCCACTTGGCTGCGTGG - Intergenic
1129297028 15:74605106-74605128 CCCTAGTCCACATGCCAGCCAGG - Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141667919 16:85475367-85475389 CCATAGCCCAAAGGCTAGGGCGG + Intergenic
1141808002 16:86354643-86354665 CCAGAGCACACAGGCCAGAGCGG + Intergenic
1142139224 16:88465310-88465332 CCGTGGCCCACAGGCCTGCGGGG + Intronic
1144497508 17:15757785-15757807 CCACAGCCTACAAGTCAGCCAGG + Intergenic
1144629301 17:16862269-16862291 CCACAGCCTACAAGTCAGCCAGG + Intergenic
1144652124 17:17013846-17013868 CCACAGCCTACAAGTCAGCCAGG - Intergenic
1145160872 17:20572835-20572857 CCACAGCCTACAAGTCAGCCAGG + Intergenic
1148178321 17:45585878-45585900 CCACAGCTCACAATCCCGCGTGG - Intergenic
1148343999 17:46891283-46891305 CCATAGCCCACAGGGCAGGCAGG + Intergenic
1148779298 17:50112551-50112573 CCATTGCCCTCAGGCCATCGTGG - Intronic
1151197455 17:72441667-72441689 CCACAGCACAGAAGCCAGTGGGG - Intergenic
1152351396 17:79785764-79785786 CCATAGCCCACAAGCCAGCGTGG + Exonic
1153773332 18:8432799-8432821 CCCTTGCCCGCAAGCCATCGGGG - Intergenic
1154454838 18:14511097-14511119 CCAAAGCCCACAGGCCAGAAGGG + Intronic
1161031250 19:2058703-2058725 CCATCTCCCTCAAGCCAGGGAGG + Intergenic
1162391165 19:10391015-10391037 CCTTTGCCCACCAGCCATCGTGG - Intergenic
1162527849 19:11217031-11217053 CCACAGCACACACGCCAGCAAGG + Exonic
1162824786 19:13244734-13244756 CCACAGCCCTCAGGCCAGTGTGG - Intronic
1167671992 19:50858905-50858927 CTGTAGCCCCCAAGCCAGTGAGG + Intronic
925014387 2:510714-510736 CCACAGACCACAAGACAACGTGG - Intergenic
926128684 2:10286865-10286887 CCATTGCCCTGAAGCCACCGTGG - Intergenic
927077060 2:19589152-19589174 CCATAGCCCACCTGCAAGCTGGG + Intergenic
929780872 2:44956016-44956038 CCAAATCCCACAGGCCAGGGTGG - Intergenic
932277454 2:70462303-70462325 CCAGAGCTCACAAGCCATCAGGG + Intronic
933652500 2:84860757-84860779 CCATTGCCTACAAGGCAGAGAGG - Intronic
936285731 2:111179812-111179834 CCATTTCCCACAACTCAGCGAGG + Intergenic
937355038 2:121192876-121192898 CCAGAGCCCACCAGGCAGAGTGG + Intergenic
937565098 2:123275802-123275824 CCATAGCCCTCAAGCAATCCAGG - Intergenic
948380212 2:237545297-237545319 CCACAGCACACACGCCACCGTGG + Intronic
1172894559 20:38291402-38291424 CCAGAGGCCACAAGGCAGCCTGG + Intronic
1175202726 20:57289332-57289354 CCACATCCCACAAAGCAGCGGGG + Intergenic
1175379677 20:58554111-58554133 CCTGAGGCCACAACCCAGCGTGG + Intergenic
1175974041 20:62701549-62701571 CCAGAGGCCAGAAGACAGCGGGG - Intergenic
1176819327 21:13642211-13642233 CCAAAGCCCACAGGCCAGAAGGG - Intergenic
1180994937 22:19960927-19960949 ACATAGCCCACAGGGCAGTGTGG + Intronic
953509613 3:43522964-43522986 CCATACCCCAGAAGCAAGGGAGG + Intronic
962343994 3:134606621-134606643 ACAGAGCCCACAGGCCAGCAAGG - Intronic
979610917 4:122688070-122688092 CCAGAGTCCAGAAGCCAGTGGGG - Intergenic
982600482 4:157443310-157443332 CCGTAGCCCACAAGCCTATGTGG + Intergenic
984973658 4:185210804-185210826 CCAAATCACAGAAGCCAGCGGGG - Intronic
985704179 5:1391135-1391157 CCACAGCTCACACGCCAGAGAGG + Intergenic
985971389 5:3381213-3381235 CCATGGCCTCCAAGCCAGCTAGG - Intergenic
999305623 5:150517811-150517833 CCACAGCACTCAAGCCTGCGAGG + Intronic
1001083412 5:168683453-168683475 CCATCACACACAAGCCAGGGTGG + Intronic
1002633148 5:180594175-180594197 CCATTTCCCACAAGCCTGCAGGG + Intergenic
1006638005 6:35474211-35474233 CATTAGCCCACAAGCCAGCCAGG - Exonic
1013441805 6:110179242-110179264 CCACCGCCCACCCGCCAGCGGGG - Intronic
1013635029 6:112021029-112021051 CCATAGCCCACATGCCAAGCAGG - Intergenic
1015954932 6:138589424-138589446 CCGTAGTGCACAAGCCAGCCAGG - Intronic
1017202352 6:151769208-151769230 CTGTGGCCCAGAAGCCAGCGTGG - Intronic
1017793591 6:157822946-157822968 CCATGGCCCGCAACCCTGCGTGG - Intronic
1022772952 7:33494043-33494065 GCAAAACCCACAAGCCAGAGGGG - Intronic
1022884274 7:34625633-34625655 CCTTAGCCCTGAAGCCAGAGAGG + Intergenic
1032032590 7:128496823-128496845 CCATAGCACACACTCCAGCCTGG - Intronic
1033317165 7:140307073-140307095 CCCTAGCCCACAATACAGCCAGG - Intronic
1034348854 7:150403822-150403844 CCAGAGGCCACAAGCCAGACGGG + Intronic
1039845079 8:41320399-41320421 CCATACCCCACAGGACAGAGTGG + Intergenic
1042194649 8:66221855-66221877 GCATAGCTCAAAAGCCAGCTTGG - Intergenic
1049418967 8:142508480-142508502 CCATAGCCCCAAAGCCTGCCTGG + Intronic
1049804970 8:144534579-144534601 CCACAGCCTAAAAGCCAGGGAGG - Intronic
1056443622 9:86643895-86643917 CCATCTCCCACCAGCCAGCATGG - Intergenic
1058406965 9:104687707-104687729 ACATAGCCCTAAAGACAGCGAGG + Intergenic
1060286159 9:122254716-122254738 GCATAGCCCATAAGCCTGCTTGG - Intronic
1061009875 9:127948537-127948559 CCAGAGCCCCCAAGCCAGGAGGG - Intronic
1062238003 9:135521849-135521871 CCAGCCCCCACAAGCCAGCCAGG - Intronic
1203528031 Un_GL000213v1:107359-107381 CCAAAGCCCACAGGCCAGAAGGG + Intergenic
1203544543 Un_KI270743v1:119292-119314 CCAAAGCCCACAAACCAGAACGG + Intergenic
1185498942 X:583291-583313 CCAGAGCCCTGAAGCCATCGAGG - Intergenic
1187737814 X:22322445-22322467 CCATAGCCCCCAGACCAGCCTGG - Intergenic
1191899044 X:66022484-66022506 CCATAGGGCACATGCCAGAGAGG - Exonic
1194537252 X:95120024-95120046 CCAAAGCCCACAAGCCAGAATGG + Intergenic
1194867489 X:99086467-99086489 CCAAAGCCCAAAGGCCAGAGTGG - Intergenic
1195078656 X:101350771-101350793 CCATGGCCCATAAGCCCCCGAGG + Intronic
1199620683 X:149697639-149697661 CCTTAGGCCTCAAGCCAGCCAGG - Intronic
1199964432 X:152807774-152807796 CAATAGCCCAGAAGGCAGTGTGG + Intergenic
1200279398 X:154763425-154763447 CTAGAGGCCACAAGCCCGCGGGG + Intronic