ID: 1152353408

View in Genome Browser
Species Human (GRCh38)
Location 17:79795468-79795490
Sequence CTACCCTGGCCGCTCGCCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152353408_1152353414 -4 Left 1152353408 17:79795468-79795490 CCTGGGGCGAGCGGCCAGGGTAG 0: 1
1: 0
2: 0
3: 15
4: 176
Right 1152353414 17:79795487-79795509 GTAGGGGATCCGGATGCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 82
1152353408_1152353419 26 Left 1152353408 17:79795468-79795490 CCTGGGGCGAGCGGCCAGGGTAG 0: 1
1: 0
2: 0
3: 15
4: 176
Right 1152353419 17:79795517-79795539 ACTTCGAAACTCGTAAGTTTTGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152353408 Original CRISPR CTACCCTGGCCGCTCGCCCC AGG (reversed) Exonic
901130909 1:6962308-6962330 TGCCCCTGGCCCCTCGCCCCAGG - Intronic
901402546 1:9024808-9024830 GTACCCTGGATGCTCACCCCTGG - Intronic
903649576 1:24914537-24914559 CCTCCCTGCCCGCTGGCCCCCGG - Intronic
904259418 1:29279878-29279900 CTACCCTGGCCCCTGACCTCAGG - Intronic
905253800 1:36666708-36666730 CTACTCTGGCCCCTGGGCCCAGG + Intergenic
905390909 1:37634803-37634825 CTACTCTGGCCGGTCGCTCCGGG + Exonic
909214690 1:72871501-72871523 CTACCCTCGCTGCTCGACTCTGG + Intergenic
911664691 1:100539456-100539478 CTGTCCTGGGCGCTCGCCCTGGG + Exonic
915340371 1:155173940-155173962 CTACCGTGCCCGCCCGCCCCTGG - Intronic
915499070 1:156301941-156301963 CTGCCCAGGCCTCGCGCCCCGGG - Intergenic
915553135 1:156646648-156646670 GGACCCTGGCCCCTGGCCCCTGG + Intronic
915570377 1:156742205-156742227 TTACCCTGGCCCCTCTCCCTTGG - Intronic
915899217 1:159834399-159834421 TTGCCCTGGCCCCTGGCCCCTGG + Intronic
915978215 1:160404345-160404367 CTTCCCTGGCACCTCACCCCAGG - Intronic
916719743 1:167475307-167475329 CTACCCAGTCCCCTCTCCCCTGG + Intronic
918041489 1:180916608-180916630 CTTCCCAGGCCGCCTGCCCCTGG + Exonic
918484258 1:185012721-185012743 CCACCCTTCCCCCTCGCCCCTGG + Intergenic
924904363 1:248435641-248435663 CCACCCTTCCCGCTCCCCCCAGG + Intergenic
924944832 1:248838932-248838954 CTACCCTAGCCCCTTGCCCGTGG - Intronic
1064643087 10:17434055-17434077 CTCCCCTGGCTTCTCTCCCCTGG + Intronic
1065022242 10:21510054-21510076 CTGGCCCTGCCGCTCGCCCCGGG + Intergenic
1068763078 10:60733620-60733642 TTACCCTGGCCCCTGGGCCCTGG - Intergenic
1069981350 10:72255089-72255111 ATGCCCTGGCCTCTCACCCCAGG + Intergenic
1070758258 10:79006728-79006750 CTCCCCAGGCCCCTGGCCCCTGG + Intergenic
1072680161 10:97499967-97499989 CTGCCCTGGCATTTCGCCCCGGG + Intronic
1072693934 10:97589526-97589548 CTACCCTGACAGCTGTCCCCAGG - Intronic
1076138696 10:128062993-128063015 GCACCCTGGCCGTTGGCCCCTGG - Intronic
1076663243 10:132069249-132069271 CTCCCCTGGCCTCCCACCCCTGG - Intergenic
1076774899 10:132689867-132689889 CCACCCTGCCCCATCGCCCCAGG - Intronic
1077044269 11:537561-537583 CGGCCCTGGCAGCTCGGCCCTGG - Exonic
1077523249 11:3048817-3048839 CTCACCTGGCCCCTGGCCCCTGG + Intronic
1080290188 11:30662168-30662190 CTGCTCTGGCCTCTGGCCCCTGG - Intergenic
1083170612 11:60922120-60922142 CCCCCTTGGCCGCTCGCCTCTGG - Exonic
1083202709 11:61130094-61130116 CTCCCTTGCCCGCTCGCCCCAGG - Intergenic
1083681492 11:64353866-64353888 CTGCCCTGGCCTCTGACCCCAGG + Intronic
1084480079 11:69415045-69415067 CTCTCCTGGCCCCTCTCCCCCGG - Intergenic
1085281478 11:75333932-75333954 CTGCCCTGGCAGCTCCCCTCAGG + Intronic
1086437955 11:86800386-86800408 CTCCCCTCGCCGCTCGCCTGCGG - Exonic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1091690012 12:2589542-2589564 CTGCCCCGGCCTCTCGCCTCAGG - Intronic
1092717910 12:11410587-11410609 CCACCCTGGCTTCTAGCCCCAGG + Intronic
1097456938 12:59811093-59811115 CTAACCTGGCCCCTGACCCCAGG - Intergenic
1098893440 12:76031877-76031899 CTACCCAGGGCGATCGCCCAAGG + Exonic
1100505593 12:95217428-95217450 CGACCCCGGCGGCTCGCGCCCGG - Exonic
1100611575 12:96195030-96195052 CAACCCTGGGAGCTCGCCCAGGG + Intronic
1102424168 12:112827746-112827768 CTCCCCTGGCCCCCCACCCCAGG - Intronic
1104140759 12:125984048-125984070 CAACCCTGGCCCCTGGCCCCAGG - Intergenic
1104834777 12:131781934-131781956 CTACCGTGGGTGCTGGCCCCTGG + Intronic
1106130323 13:26934190-26934212 CTACGCTGGCCCCTGACCCCAGG - Intergenic
1106413191 13:29525117-29525139 CTTCCCTGGCCACTGTCCCCTGG + Intronic
1107009016 13:35649130-35649152 CTTCCCTGGCAGTTCTCCCCAGG - Intronic
1110190966 13:72728080-72728102 CTTGCCTGCCCGCTCGCCCCTGG + Intronic
1113009472 13:105747316-105747338 CTACCCTAGCCCCCCACCCCGGG - Intergenic
1113602419 13:111579600-111579622 CTTCCCTGGCCCCCAGCCCCTGG + Intergenic
1113612898 13:111660425-111660447 CTGCCCTGGCCGCATGCCCTGGG - Intronic
1113946560 13:114047842-114047864 CTACCCTGGCCCACAGCCCCGGG - Intronic
1113955300 13:114097198-114097220 CCACCCAGGCCTCTCGCCCCTGG - Intronic
1118752450 14:68816797-68816819 CTCCCGCGGCCGCTCTCCCCCGG + Intergenic
1120809700 14:88791846-88791868 CCACCCTGGGCGCGCTCCCCGGG + Intronic
1122327294 14:100890442-100890464 CCACCCCGGCCCCCCGCCCCAGG - Intergenic
1122419688 14:101567461-101567483 CTTGCCTGGCCCCTGGCCCCCGG - Intergenic
1122616348 14:103020504-103020526 CTAGCCTGGCCTCTGGCCCTCGG - Intronic
1122779692 14:104138487-104138509 CGCCCCTCGCCGCCCGCCCCGGG + Intergenic
1124629700 15:31329271-31329293 CTAGCCTGGCCCCTCCCCCAGGG - Intronic
1124960419 15:34389436-34389458 CTGCCCTCGCCGATCACCCCGGG - Intronic
1124977048 15:34535657-34535679 CTGCCCTCGCCGATCACCCCGGG - Intronic
1128716731 15:69914047-69914069 CCACCCTGGCCTCTCCCACCAGG + Intergenic
1130957844 15:88639644-88639666 CTTCCCTGGCCCCTCTTCCCTGG + Intronic
1131936681 15:97513724-97513746 CTCCCCTGGCCCCCCACCCCTGG - Intergenic
1136070382 16:27783915-27783937 GAACCCTGGCAGCTGGCCCCAGG - Intergenic
1136146178 16:28317824-28317846 GTACCCTGGCCACTCTGCCCCGG - Intronic
1137236362 16:46621476-46621498 CAACACTGCCCCCTCGCCCCAGG + Exonic
1137571724 16:49570804-49570826 CTGCCCTGGCCTCTGGCCCCTGG - Intronic
1138476523 16:57273478-57273500 CCACCCTGGCCTCTCCCCACTGG + Intronic
1139464658 16:67147936-67147958 CAACCCTGGGCACTGGCCCCTGG + Exonic
1139473303 16:67189709-67189731 CTACTCTGCCTGCTTGCCCCGGG - Intronic
1141833688 16:86524247-86524269 CTCACCTGGCTGCTGGCCCCTGG - Intergenic
1143104024 17:4519540-4519562 CGGCCCTGCCCGCTCGGCCCTGG + Intronic
1144726736 17:17506076-17506098 CTACCATGGCCGCTCTGACCTGG + Intronic
1145883778 17:28369263-28369285 CTACCCTGGCCCACAGCCCCTGG + Intronic
1146314516 17:31796659-31796681 CAACCCTGGTCGCTTGCACCTGG + Intergenic
1148559486 17:48597681-48597703 CTCCCCTGGGCGCCCACCCCGGG - Intronic
1148805397 17:50261287-50261309 GGACCCTGGCCGCTCCCTCCAGG - Intergenic
1149998417 17:61416927-61416949 CTCCCCTGGCCGCGCTTCCCTGG - Intergenic
1150134910 17:62690181-62690203 CTACCATGGCAGCTGTCCCCAGG + Exonic
1150601258 17:66653002-66653024 CTCACCTGGCCCCTGGCCCCTGG + Intronic
1150921165 17:69484906-69484928 CTACCCTTCCCTCTAGCCCCTGG - Intronic
1152091375 17:78249581-78249603 CATCCCTGGCAGCTGGCCCCAGG - Intergenic
1152353408 17:79795468-79795490 CTACCCTGGCCGCTCGCCCCAGG - Exonic
1152573722 17:81131286-81131308 CTGCCCTGGGAGCTCGGCCCTGG - Intronic
1152628736 17:81400111-81400133 CTTCCCTGGCCACCCTCCCCCGG + Intronic
1155211792 18:23608346-23608368 CTTCCCTGGCGGCTCCTCCCAGG + Intronic
1156474524 18:37397336-37397358 CTAGCCTGGCCCCAAGCCCCAGG - Intronic
1160811956 19:1016689-1016711 CTGCCCTGGCCCCTCCCTCCTGG - Intronic
1161063393 19:2226378-2226400 CCAAGCTGGCCGCTCACCCCAGG + Exonic
1161221455 19:3119964-3119986 CTCCCCTGGCCGCCATCCCCAGG - Intronic
1161401180 19:4066735-4066757 CTCCCTCGGCCGCTCGCCTCCGG + Exonic
1161767233 19:6214454-6214476 CTCCCCTGGCCGCCTGACCCTGG + Intronic
1165329099 19:35131555-35131577 CCTCCCTGGCCTCTTGCCCCAGG - Exonic
1165773337 19:38390489-38390511 CTACCCTCCCCGCATGCCCCAGG - Intronic
1165961660 19:39539899-39539921 CTTCCCTGGCCGCCGGCACCGGG + Exonic
1166366630 19:42281333-42281355 CATCCCTGGCTGCTCGCCCCAGG + Intronic
1167489969 19:49786888-49786910 CCACCCTGGCCCCTTGACCCTGG - Intronic
1167602817 19:50464584-50464606 CCAGCCTGGCCGGTGGCCCCGGG + Intronic
1167643370 19:50693861-50693883 CTCCCCTGCCCCCTTGCCCCCGG - Intronic
1168538556 19:57191821-57191843 CGACCCTGGCCGGTTGCCCGGGG - Exonic
925294840 2:2769534-2769556 CCACCCTGACCGCTCGCCATCGG - Intergenic
926320617 2:11746466-11746488 CGGCCCTGCCCGCTCACCCCTGG - Intronic
927531760 2:23811595-23811617 CTCCCCTGGCCTCCCACCCCCGG - Intronic
927811871 2:26184992-26185014 CTGCCCGCGCCGCGCGCCCCCGG + Exonic
928199842 2:29240806-29240828 ATACCCTGGCAGCTGGTCCCTGG - Intronic
937229523 2:120389425-120389447 CCTCCCTGGCCTCTGGCCCCGGG + Intergenic
937438907 2:121900670-121900692 CTTCCCTGGTCCCCCGCCCCTGG - Intergenic
941021086 2:160408060-160408082 CTCCCCGGGCCGCCCGGCCCCGG - Intronic
947874590 2:233459821-233459843 GTACCCTGGCGGCTGGACCCAGG - Exonic
948642886 2:239386480-239386502 CTCCCCTGGCCGGCCACCCCGGG - Intronic
948874374 2:240819283-240819305 CTAGGCTGGCGGCGCGCCCCCGG - Intronic
1168853228 20:990668-990690 TTACACTTCCCGCTCGCCCCTGG - Intronic
1169120610 20:3093361-3093383 CTATCCTGCCCACTCGCCCCAGG - Intergenic
1172181889 20:33008550-33008572 CTGCCCTGGCCGCTGCCCACAGG - Exonic
1175831068 20:61965783-61965805 CTCCCCGGGCCCCCCGCCCCTGG + Intronic
1176256575 20:64156138-64156160 CTACCCTGGGCACTGGGCCCAGG - Intronic
1179290788 21:40016112-40016134 TTACCCTGGGCCCTCGCTCCAGG - Intronic
1181168552 22:20995851-20995873 CTATCCTGGCCGCCCGCTCCAGG + Exonic
1182014193 22:27025471-27025493 CTCCCCTGGCCGGTCACCCAGGG - Intergenic
1182451792 22:30426116-30426138 CTACCCTGGTGGGTCGCCCAGGG + Intronic
1182903917 22:33920621-33920643 CTCCCCTAGCCCCGCGCCCCCGG - Intronic
952410185 3:33042172-33042194 CTACCCTTGCCGCACCTCCCAGG + Intronic
960846122 3:122006004-122006026 CTACCCTAGCCTCTCCTCCCTGG + Intronic
967997139 3:195175179-195175201 CTTCCCTGACCGCTCTGCCCTGG - Intronic
968473342 4:791805-791827 CCACCATGCCCGCTCACCCCTGG + Intronic
968689488 4:1983416-1983438 CTACCCTGGCCGTCCGCCTTGGG + Exonic
969480665 4:7445334-7445356 CAACCCTGGCTCCTCTCCCCCGG - Intronic
970616342 4:17771730-17771752 CTGCCCTGGCCTCTCAGCCCAGG + Intronic
975449827 4:74511318-74511340 CTCCCCTAGCCCCTCACCCCCGG - Intergenic
985643315 5:1073794-1073816 CCACCCTGGCTGCAGGCCCCAGG - Exonic
993727363 5:91383449-91383471 CTCCCTTGCCCGCTCGCTCCCGG + Intergenic
995724684 5:115170289-115170311 CAGCCCTGGCCCCTGGCCCCTGG + Intronic
997903897 5:137795032-137795054 CTGCCCTGGCCCCTCCCTCCCGG - Intergenic
999448534 5:151660755-151660777 CTACCCTGTCCTCCCGCCCGGGG + Intergenic
1002098080 5:176843833-176843855 CAGCCCTGGCCCCTGGCCCCTGG + Intronic
1002484235 5:179523764-179523786 CCACCCTGTCCTCTCTCCCCAGG + Intergenic
1002897667 6:1389098-1389120 CCTCCCTGGCCGCCCTCCCCAGG - Intergenic
1006320676 6:33317648-33317670 CTTACCGGGCCGCGCGCCCCCGG + Exonic
1007091894 6:39189973-39189995 ACACCCTGCCCGCTGGCCCCAGG - Exonic
1014205418 6:118651226-118651248 CTATCCCGGCCGCTGGCCTCCGG + Intronic
1015396138 6:132737152-132737174 CTACCCTCTCCCCTGGCCCCAGG + Intergenic
1018046362 6:159969434-159969456 CCACGCCGGCCGCTCACCCCGGG - Intronic
1018550837 6:164997054-164997076 CTGCCCTGGCCCCTCAGCCCCGG + Intergenic
1019661642 7:2227489-2227511 CTTCCCTGGCCTCTACCCCCTGG - Intronic
1024639402 7:51316972-51316994 CTTCCCCGGACGCTCGCCGCGGG - Intergenic
1029701457 7:102249054-102249076 CCAGCCTGGCTGCCCGCCCCAGG - Exonic
1034869959 7:154675205-154675227 CTCCCCTAGCCCCCCGCCCCCGG - Intronic
1035234449 7:157487406-157487428 CTCCCCTGGCCCCTCTCCCAAGG - Intergenic
1035285340 7:157802463-157802485 CTTTCCTGCCCGCTCGTCCCTGG + Intronic
1035373935 7:158395451-158395473 CGCCCCTCGCCCCTCGCCCCTGG - Intronic
1035374004 7:158395619-158395641 CGCCCCTGGCCCCTCGCCCCTGG - Intronic
1035374009 7:158395633-158395655 CTCCCCTCGCGCCTCGCCCCTGG - Intronic
1035622074 8:1042603-1042625 CTTCCCTGGCCACTGGCTCCTGG - Intergenic
1035850116 8:2910599-2910621 CAATCCTGGCCTCTCGTCCCTGG - Intergenic
1036103930 8:5819259-5819281 TTAACCTGGTCGCCCGCCCCCGG + Intergenic
1037787564 8:21911853-21911875 CTCCCCTGGGGGCTCTCCCCAGG - Intronic
1038407590 8:27333672-27333694 CCAGCCTGGCCGCTTCCCCCTGG + Intronic
1044824224 8:96181037-96181059 CTACCCTGGCCTCTGGACACAGG - Intergenic
1049373962 8:142280362-142280384 CGAACCTGGCTGCTCTCCCCAGG - Intronic
1049597040 8:143489496-143489518 CTCCCCTGGCCCCTCTCCCCTGG - Intronic
1049674392 8:143883286-143883308 CGCCCCTGGCCCCTGGCCCCTGG - Intergenic
1049841806 8:144777838-144777860 CTTCCCTTCCCTCTCGCCCCAGG - Intronic
1056735226 9:89203764-89203786 CTGCCCTGCCCACTTGCCCCTGG - Intergenic
1057090324 9:92252131-92252153 CTTCCCTGTCAGCTCGCCTCAGG - Intronic
1060673017 9:125486873-125486895 CTTCCCTGGCCGCAAGCCCCCGG + Intronic
1061250922 9:129425991-129426013 CCACACTGGCCCCTGGCCCCTGG + Intergenic
1061411641 9:130425145-130425167 CTACCCTGTCTGCACACCCCAGG - Intronic
1061864283 9:133484623-133484645 CTTCCGTGGCCTCCCGCCCCAGG + Intergenic
1186888662 X:13938842-13938864 CGACCCTCGGCGCTCGCCCGGGG - Intergenic
1190161912 X:48038205-48038227 CTCCCCTTGCCTCTCACCCCTGG - Intronic
1198806656 X:140501374-140501396 CTCCCCTGGCCCCTCAACCCGGG - Intergenic
1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG + Intronic
1200104188 X:153703304-153703326 CTGCCCTGGCCCCTGGCCCCTGG + Intronic
1200654155 Y:5880218-5880240 CTACCCTGGCTATTCTCCCCAGG + Intergenic
1200654402 Y:5884363-5884385 CTACCCTGGCTATTCTCCCCAGG + Intergenic
1200684266 Y:6245598-6245620 CAACCCTGGCGGCTGGCCTCTGG + Intergenic
1200686905 Y:6265926-6265948 CAACCCTGGCGGCTGGCCTCTGG + Intergenic
1200989783 Y:9336843-9336865 CAACCCTGGCGGCTGGCCTCTGG + Intergenic
1200992451 Y:9357176-9357198 CAACCCTGGCGGCTGGCCTCTGG + Intergenic
1200995103 Y:9377454-9377476 CAACCCTGGCGGCTGGCCTCTGG + Intronic
1200997768 Y:9397800-9397822 CAACCCTGGCGGCTGGCCTCTGG + Intergenic
1201002939 Y:9486646-9486668 CAACCCTGGCGGCTGGCCTCTGG + Intronic
1201005597 Y:9506929-9506951 CAACCCTGGCGGCTGGCCTCTGG + Intergenic
1201008258 Y:9527259-9527281 CAACCCTGGCGGCTGGCCTCTGG + Intergenic
1201010857 Y:9547444-9547466 CAACCCTGGCGGCTGGCCTCTGG + Intergenic
1201048368 Y:9908788-9908810 CAACCCTGGCGGCTGGCCTCTGG - Intergenic