ID: 1152354103

View in Genome Browser
Species Human (GRCh38)
Location 17:79798294-79798316
Sequence CGTCCCCCAGCTTCCCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152354103_1152354113 9 Left 1152354103 17:79798294-79798316 CCAGCGCGGGAAGCTGGGGGACG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1152354113 17:79798326-79798348 CCAGTGCGGGCTGGGCGAGAGGG 0: 1
1: 0
2: 2
3: 24
4: 345
1152354103_1152354108 0 Left 1152354103 17:79798294-79798316 CCAGCGCGGGAAGCTGGGGGACG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1152354108 17:79798317-79798339 TCGCCGGGTCCAGTGCGGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1152354103_1152354114 27 Left 1152354103 17:79798294-79798316 CCAGCGCGGGAAGCTGGGGGACG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1152354114 17:79798344-79798366 GAGGGTCTCACGCGCGAAGATGG 0: 1
1: 0
2: 0
3: 0
4: 28
1152354103_1152354106 -5 Left 1152354103 17:79798294-79798316 CCAGCGCGGGAAGCTGGGGGACG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1152354106 17:79798312-79798334 GGACGTCGCCGGGTCCAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 43
1152354103_1152354111 8 Left 1152354103 17:79798294-79798316 CCAGCGCGGGAAGCTGGGGGACG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1152354111 17:79798325-79798347 TCCAGTGCGGGCTGGGCGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 181
1152354103_1152354115 30 Left 1152354103 17:79798294-79798316 CCAGCGCGGGAAGCTGGGGGACG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1152354115 17:79798347-79798369 GGTCTCACGCGCGAAGATGGCGG 0: 1
1: 0
2: 0
3: 0
4: 26
1152354103_1152354109 1 Left 1152354103 17:79798294-79798316 CCAGCGCGGGAAGCTGGGGGACG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1152354109 17:79798318-79798340 CGCCGGGTCCAGTGCGGGCTGGG 0: 1
1: 0
2: 1
3: 1
4: 96
1152354103_1152354107 -4 Left 1152354103 17:79798294-79798316 CCAGCGCGGGAAGCTGGGGGACG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1152354107 17:79798313-79798335 GACGTCGCCGGGTCCAGTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152354103 Original CRISPR CGTCCCCCAGCTTCCCGCGC TGG (reversed) Intronic