ID: 1152355195

View in Genome Browser
Species Human (GRCh38)
Location 17:79803487-79803509
Sequence GGGAGCACCAACCCTCCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152355191_1152355195 -3 Left 1152355191 17:79803467-79803489 CCCAGCTCATGAGAAAGGCGGGG No data
Right 1152355195 17:79803487-79803509 GGGAGCACCAACCCTCCCACGGG No data
1152355193_1152355195 -4 Left 1152355193 17:79803468-79803490 CCAGCTCATGAGAAAGGCGGGGA No data
Right 1152355195 17:79803487-79803509 GGGAGCACCAACCCTCCCACGGG No data
1152355183_1152355195 11 Left 1152355183 17:79803453-79803475 CCCTCCTCCCGTGACCCAGCTCA No data
Right 1152355195 17:79803487-79803509 GGGAGCACCAACCCTCCCACGGG No data
1152355185_1152355195 7 Left 1152355185 17:79803457-79803479 CCTCCCGTGACCCAGCTCATGAG No data
Right 1152355195 17:79803487-79803509 GGGAGCACCAACCCTCCCACGGG No data
1152355181_1152355195 28 Left 1152355181 17:79803436-79803458 CCACGGTTGATGAGCGCCCCTCC No data
Right 1152355195 17:79803487-79803509 GGGAGCACCAACCCTCCCACGGG No data
1152355187_1152355195 3 Left 1152355187 17:79803461-79803483 CCGTGACCCAGCTCATGAGAAAG No data
Right 1152355195 17:79803487-79803509 GGGAGCACCAACCCTCCCACGGG No data
1152355182_1152355195 12 Left 1152355182 17:79803452-79803474 CCCCTCCTCCCGTGACCCAGCTC No data
Right 1152355195 17:79803487-79803509 GGGAGCACCAACCCTCCCACGGG No data
1152355186_1152355195 4 Left 1152355186 17:79803460-79803482 CCCGTGACCCAGCTCATGAGAAA No data
Right 1152355195 17:79803487-79803509 GGGAGCACCAACCCTCCCACGGG No data
1152355184_1152355195 10 Left 1152355184 17:79803454-79803476 CCTCCTCCCGTGACCCAGCTCAT No data
Right 1152355195 17:79803487-79803509 GGGAGCACCAACCCTCCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152355195 Original CRISPR GGGAGCACCAACCCTCCCAC GGG Intergenic
No off target data available for this crispr