ID: 1152356958

View in Genome Browser
Species Human (GRCh38)
Location 17:79812162-79812184
Sequence ATGGATTCCTCCGCCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152356953_1152356958 7 Left 1152356953 17:79812132-79812154 CCATCTTCAAGTTTCTGCGTGCT No data
Right 1152356958 17:79812162-79812184 ATGGATTCCTCCGCCCAGGTGGG No data
1152356950_1152356958 29 Left 1152356950 17:79812110-79812132 CCAGGTCATTTATAATAGATCCC No data
Right 1152356958 17:79812162-79812184 ATGGATTCCTCCGCCCAGGTGGG No data
1152356951_1152356958 9 Left 1152356951 17:79812130-79812152 CCCCATCTTCAAGTTTCTGCGTG No data
Right 1152356958 17:79812162-79812184 ATGGATTCCTCCGCCCAGGTGGG No data
1152356952_1152356958 8 Left 1152356952 17:79812131-79812153 CCCATCTTCAAGTTTCTGCGTGC No data
Right 1152356958 17:79812162-79812184 ATGGATTCCTCCGCCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152356958 Original CRISPR ATGGATTCCTCCGCCCAGGT GGG Intergenic
No off target data available for this crispr