ID: 1152361500

View in Genome Browser
Species Human (GRCh38)
Location 17:79835129-79835151
Sequence CAGGTCGTACATTTTGGGGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152361488_1152361500 23 Left 1152361488 17:79835083-79835105 CCGGGCAGGTGGGGCTGGGCGCC 0: 1
1: 1
2: 5
3: 63
4: 477
Right 1152361500 17:79835129-79835151 CAGGTCGTACATTTTGGGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 65
1152361492_1152361500 -1 Left 1152361492 17:79835107-79835129 CCTTGTGGCCGCCCTGGTACTGC 0: 1
1: 0
2: 1
3: 17
4: 138
Right 1152361500 17:79835129-79835151 CAGGTCGTACATTTTGGGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 65
1152361491_1152361500 2 Left 1152361491 17:79835104-79835126 CCTCCTTGTGGCCGCCCTGGTAC 0: 1
1: 0
2: 0
3: 18
4: 129
Right 1152361500 17:79835129-79835151 CAGGTCGTACATTTTGGGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 65
1152361484_1152361500 30 Left 1152361484 17:79835076-79835098 CCCAGGTCCGGGCAGGTGGGGCT 0: 1
1: 1
2: 0
3: 26
4: 247
Right 1152361500 17:79835129-79835151 CAGGTCGTACATTTTGGGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 65
1152361494_1152361500 -9 Left 1152361494 17:79835115-79835137 CCGCCCTGGTACTGCAGGTCGTA 0: 1
1: 0
2: 1
3: 4
4: 54
Right 1152361500 17:79835129-79835151 CAGGTCGTACATTTTGGGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 65
1152361485_1152361500 29 Left 1152361485 17:79835077-79835099 CCAGGTCCGGGCAGGTGGGGCTG 0: 1
1: 0
2: 6
3: 43
4: 349
Right 1152361500 17:79835129-79835151 CAGGTCGTACATTTTGGGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152361500 Original CRISPR CAGGTCGTACATTTTGGGGT CGG Exonic
904254878 1:29248488-29248510 CAGGTTGCACATTTAGGGGCTGG - Intronic
906418643 1:45643615-45643637 CAGATCGTAAAGTTTGGGCTAGG - Intronic
906767683 1:48449529-48449551 CATGTCATACAGTTTGGGTTTGG - Intronic
910665819 1:89725051-89725073 CAGGAGGAACATTTAGGGGTTGG + Intronic
921327507 1:214001093-214001115 CAGATGGTACCTTTTGGAGTGGG - Intronic
921713508 1:218396032-218396054 CAGGTCATTCTTTTTGGAGTAGG + Intronic
1064592409 10:16907782-16907804 TAGGTCATTCATTTTGGGGCAGG - Intronic
1067929294 10:50543964-50543986 CATGCCGGACATTTTGGGGATGG - Intronic
1068891924 10:62156801-62156823 CAGGTTGTACATTCTGGTGAAGG + Intergenic
1073383108 10:103096548-103096570 GAGGTAGTAAATTTTGGGCTGGG + Intronic
1074939260 10:118218723-118218745 GAGGTCATACAAGTTGGGGTGGG + Intergenic
1078106435 11:8361057-8361079 CAGGCCCAACATTTTTGGGTGGG + Intergenic
1080900593 11:36486755-36486777 CACGTCATACATTTTGCTGTTGG - Intergenic
1081618426 11:44604181-44604203 AAGGTCTGACATTTGGGGGTGGG - Intronic
1083413375 11:62509121-62509143 CAGGTTATACATTTTGGGGCAGG - Intronic
1089103691 11:115984687-115984709 TAGGTCCTACCTTTTTGGGTGGG - Intergenic
1089655752 11:119945643-119945665 GAGATGGTACATTTTGGGGTTGG + Intergenic
1089658729 11:119971703-119971725 CAGGTAGTTCTTTTTAGGGTAGG - Intergenic
1091166220 11:133478513-133478535 CAGGTGGTATATTTGGGGTTGGG - Intronic
1094254712 12:28409989-28410011 AAGGTTGTACATTCTGGTGTTGG + Intronic
1102703078 12:114856779-114856801 CAGGTAGCACATGTTTGGGTTGG - Intergenic
1103988295 12:124781448-124781470 CAGGCCCTACAACTTGGGGTTGG - Intronic
1104258711 12:127163139-127163161 CAGCACGAACATTTTGTGGTGGG - Intergenic
1104429936 12:128707957-128707979 GGGGTTGTATATTTTGGGGTGGG - Intergenic
1106571385 13:30931378-30931400 CAGGAAATACATTTTGGAGTTGG - Intergenic
1109537357 13:63738420-63738442 AAGGCCGCCCATTTTGGGGTGGG - Intergenic
1118819908 14:69338537-69338559 CTGGAGGTACATGTTGGGGTCGG - Intronic
1148337788 17:46852671-46852693 CAGGCTGTACATATTGGAGTTGG - Intronic
1152128098 17:78459480-78459502 CAGGTGTTACATTTTGGGGACGG + Intronic
1152361500 17:79835129-79835151 CAGGTCGTACATTTTGGGGTCGG + Exonic
1160831044 19:1104956-1104978 AATGTGGCACATTTTGGGGTTGG + Intronic
1164723142 19:30446319-30446341 CAGGTGGTACATTTTTCAGTGGG + Intronic
1165190439 19:34058553-34058575 CAGGTTGTGCATTTTGGGGAGGG - Intergenic
927241502 2:20923379-20923401 CAGGTGGGACATTTTGAGGTGGG + Intergenic
927566777 2:24120324-24120346 AAGGTCGTACATTTTGGAATTGG + Intronic
930547768 2:52791709-52791731 CAAGAAGTACATTTTGGGGTGGG - Intergenic
940491743 2:154370622-154370644 AAGGAAGAACATTTTGGGGTTGG + Intronic
940556896 2:155240254-155240276 CAGGTTATGCATTTTGGGGAAGG - Intergenic
943464781 2:188216287-188216309 CAGGTCCGATAGTTTGGGGTAGG - Intergenic
948783474 2:240339153-240339175 CTGGCCATATATTTTGGGGTGGG - Intergenic
1170062136 20:12270214-12270236 CAGGTCTTACCTTTTTGCGTGGG - Intergenic
1182130721 22:27848520-27848542 CAGACAGTACATTTTGGGGAAGG + Intergenic
1182711117 22:32323910-32323932 GAGGTTGTCCATTCTGGGGTGGG + Intergenic
1183707569 22:39483846-39483868 CAGGTAGAACAATCTGGGGTAGG - Intronic
1184398645 22:44260783-44260805 GAGGTTGTCCATTCTGGGGTGGG + Intronic
952845883 3:37687841-37687863 CAGGTAGTTTATTTGGGGGTGGG + Intronic
962188003 3:133280399-133280421 CAGGCGGTAGATGTTGGGGTGGG + Intronic
965496568 3:169405729-169405751 GAGGTAGTACATTTAGGGGAAGG - Intronic
968971378 4:3797256-3797278 CAGCACCTACCTTTTGGGGTGGG + Intergenic
977163394 4:93664627-93664649 CAGGAAGAATATTTTGGGGTGGG + Intronic
987150965 5:15039351-15039373 TAGGACTTATATTTTGGGGTTGG + Intergenic
988183400 5:27828212-27828234 TGGGTCTGACATTTTGGGGTGGG - Intergenic
988433340 5:31145329-31145351 CAAGTCGTTCACTTGGGGGTAGG - Intergenic
992191533 5:74296715-74296737 CAGATTGAACAGTTTGGGGTGGG - Intergenic
992493818 5:77271865-77271887 CAGGTGGTACATGTTGGGGAGGG + Intronic
1002079777 5:176730514-176730536 CAGGTTGTATTTTCTGGGGTTGG - Intergenic
1006407188 6:33852156-33852178 CAGGTCCTGCTTTCTGGGGTGGG + Intergenic
1022887606 7:34662512-34662534 CAGGAGATACATTTGGGGGTTGG - Intronic
1026427455 7:70310646-70310668 CAGGCAGTAGACTTTGGGGTGGG + Intronic
1029220328 7:98983569-98983591 CAGGTTTTCTATTTTGGGGTAGG + Intronic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1050008325 9:1158364-1158386 TAGTTCCTGCATTTTGGGGTTGG - Intergenic
1053312858 9:37030281-37030303 CCGGTCGCGCCTTTTGGGGTTGG - Intronic
1055072611 9:72182451-72182473 CAGGTCGTGCATTTTTGGCAGGG + Intronic
1056036594 9:82612794-82612816 CAGCTGCTACATTTTGGAGTTGG - Intergenic
1062377256 9:136267778-136267800 CAGGTTGTATATTTTAGGGCAGG - Intergenic
1185780481 X:2840094-2840116 CAGGTCGTATGTTTAGGTGTGGG + Intronic
1187803671 X:23094486-23094508 TAAGTCTTACATTTTGGGGAAGG - Intergenic
1192433016 X:71125384-71125406 TTGGTCGTACTGTTTGGGGTGGG + Exonic
1196270462 X:113704552-113704574 CAGGGTGAACAGTTTGGGGTTGG + Intergenic
1198242176 X:134797101-134797123 CAGGTTGTAGATTTTGGTCTTGG - Intronic
1198625017 X:138561363-138561385 CAGATACTTCATTTTGGGGTTGG - Intergenic
1199846642 X:151696294-151696316 CAGGCGCTACATTTTGGGGAGGG + Intronic
1201289579 Y:12409884-12409906 CAGGTCGTATGTTTAGGTGTGGG - Intergenic