ID: 1152363265

View in Genome Browser
Species Human (GRCh38)
Location 17:79842076-79842098
Sequence CTTTGTGGATGGTGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152363256_1152363265 15 Left 1152363256 17:79842038-79842060 CCAGCAATTGACTTCCCTTCCGT No data
Right 1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG No data
1152363258_1152363265 1 Left 1152363258 17:79842052-79842074 CCCTTCCGTGGTTATTTATTTTG No data
Right 1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG No data
1152363259_1152363265 0 Left 1152363259 17:79842053-79842075 CCTTCCGTGGTTATTTATTTTGT No data
Right 1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG No data
1152363260_1152363265 -4 Left 1152363260 17:79842057-79842079 CCGTGGTTATTTATTTTGTCTTT No data
Right 1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152363265 Original CRISPR CTTTGTGGATGGTGGGCAGA TGG Intergenic
No off target data available for this crispr