ID: 1152366068

View in Genome Browser
Species Human (GRCh38)
Location 17:79857194-79857216
Sequence AGCAGAGATGGATTCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152366068_1152366070 -6 Left 1152366068 17:79857194-79857216 CCAGGAGAGAATCCATCTCTGCT No data
Right 1152366070 17:79857211-79857233 TCTGCTGTTTGAAGCTCTCCAGG No data
1152366068_1152366071 -2 Left 1152366068 17:79857194-79857216 CCAGGAGAGAATCCATCTCTGCT No data
Right 1152366071 17:79857215-79857237 CTGTTTGAAGCTCTCCAGGTTGG No data
1152366068_1152366077 24 Left 1152366068 17:79857194-79857216 CCAGGAGAGAATCCATCTCTGCT No data
Right 1152366077 17:79857241-79857263 GGAGCCAGGGCTTGCCCCTGAGG No data
1152366068_1152366075 11 Left 1152366068 17:79857194-79857216 CCAGGAGAGAATCCATCTCTGCT No data
Right 1152366075 17:79857228-79857250 TCCAGGTTGGGATGGAGCCAGGG No data
1152366068_1152366072 -1 Left 1152366068 17:79857194-79857216 CCAGGAGAGAATCCATCTCTGCT No data
Right 1152366072 17:79857216-79857238 TGTTTGAAGCTCTCCAGGTTGGG No data
1152366068_1152366073 3 Left 1152366068 17:79857194-79857216 CCAGGAGAGAATCCATCTCTGCT No data
Right 1152366073 17:79857220-79857242 TGAAGCTCTCCAGGTTGGGATGG No data
1152366068_1152366074 10 Left 1152366068 17:79857194-79857216 CCAGGAGAGAATCCATCTCTGCT No data
Right 1152366074 17:79857227-79857249 CTCCAGGTTGGGATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152366068 Original CRISPR AGCAGAGATGGATTCTCTCC TGG (reversed) Intergenic
No off target data available for this crispr