ID: 1152366069

View in Genome Browser
Species Human (GRCh38)
Location 17:79857206-79857228
Sequence AGAGCTTCAAACAGCAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152366069_1152366073 -9 Left 1152366069 17:79857206-79857228 CCATCTCTGCTGTTTGAAGCTCT No data
Right 1152366073 17:79857220-79857242 TGAAGCTCTCCAGGTTGGGATGG No data
1152366069_1152366075 -1 Left 1152366069 17:79857206-79857228 CCATCTCTGCTGTTTGAAGCTCT No data
Right 1152366075 17:79857228-79857250 TCCAGGTTGGGATGGAGCCAGGG No data
1152366069_1152366077 12 Left 1152366069 17:79857206-79857228 CCATCTCTGCTGTTTGAAGCTCT No data
Right 1152366077 17:79857241-79857263 GGAGCCAGGGCTTGCCCCTGAGG No data
1152366069_1152366074 -2 Left 1152366069 17:79857206-79857228 CCATCTCTGCTGTTTGAAGCTCT No data
Right 1152366074 17:79857227-79857249 CTCCAGGTTGGGATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152366069 Original CRISPR AGAGCTTCAAACAGCAGAGA TGG (reversed) Intergenic
No off target data available for this crispr