ID: 1152366074

View in Genome Browser
Species Human (GRCh38)
Location 17:79857227-79857249
Sequence CTCCAGGTTGGGATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152366068_1152366074 10 Left 1152366068 17:79857194-79857216 CCAGGAGAGAATCCATCTCTGCT No data
Right 1152366074 17:79857227-79857249 CTCCAGGTTGGGATGGAGCCAGG No data
1152366069_1152366074 -2 Left 1152366069 17:79857206-79857228 CCATCTCTGCTGTTTGAAGCTCT No data
Right 1152366074 17:79857227-79857249 CTCCAGGTTGGGATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152366074 Original CRISPR CTCCAGGTTGGGATGGAGCC AGG Intergenic
No off target data available for this crispr