ID: 1152367456

View in Genome Browser
Species Human (GRCh38)
Location 17:79864837-79864859
Sequence CAGGCTAGCAGGGAAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152367456_1152367469 22 Left 1152367456 17:79864837-79864859 CCTGCACCTTCCCTGCTAGCCTG No data
Right 1152367469 17:79864882-79864904 CCTCCTCCTGCTGTGGCCTCTGG No data
1152367456_1152367465 15 Left 1152367456 17:79864837-79864859 CCTGCACCTTCCCTGCTAGCCTG No data
Right 1152367465 17:79864875-79864897 CCTCCTCCCTCCTCCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152367456 Original CRISPR CAGGCTAGCAGGGAAGGTGC AGG (reversed) Intergenic
No off target data available for this crispr