ID: 1152371987

View in Genome Browser
Species Human (GRCh38)
Location 17:79894404-79894426
Sequence CCTCATCAAAATCATCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 361}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152371982_1152371987 7 Left 1152371982 17:79894374-79894396 CCTCTTCCTCATCCTCATCAGCA No data
Right 1152371987 17:79894404-79894426 CCTCATCAAAATCATCATCATGG 0: 1
1: 0
2: 3
3: 37
4: 361
1152371981_1152371987 12 Left 1152371981 17:79894369-79894391 CCTCTCCTCTTCCTCATCCTCAT No data
Right 1152371987 17:79894404-79894426 CCTCATCAAAATCATCATCATGG 0: 1
1: 0
2: 3
3: 37
4: 361
1152371978_1152371987 26 Left 1152371978 17:79894355-79894377 CCACCATGAGCCTTCCTCTCCTC No data
Right 1152371987 17:79894404-79894426 CCTCATCAAAATCATCATCATGG 0: 1
1: 0
2: 3
3: 37
4: 361
1152371980_1152371987 16 Left 1152371980 17:79894365-79894387 CCTTCCTCTCCTCTTCCTCATCC No data
Right 1152371987 17:79894404-79894426 CCTCATCAAAATCATCATCATGG 0: 1
1: 0
2: 3
3: 37
4: 361
1152371984_1152371987 -5 Left 1152371984 17:79894386-79894408 CCTCATCAGCAGCATCACCCTCA No data
Right 1152371987 17:79894404-79894426 CCTCATCAAAATCATCATCATGG 0: 1
1: 0
2: 3
3: 37
4: 361
1152371983_1152371987 1 Left 1152371983 17:79894380-79894402 CCTCATCCTCATCAGCAGCATCA No data
Right 1152371987 17:79894404-79894426 CCTCATCAAAATCATCATCATGG 0: 1
1: 0
2: 3
3: 37
4: 361
1152371979_1152371987 23 Left 1152371979 17:79894358-79894380 CCATGAGCCTTCCTCTCCTCTTC No data
Right 1152371987 17:79894404-79894426 CCTCATCAAAATCATCATCATGG 0: 1
1: 0
2: 3
3: 37
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152371987 Original CRISPR CCTCATCAAAATCATCATCA TGG Intergenic
902005576 1:13229412-13229434 CCCCATCAAAATTATCAAAATGG + Intergenic
902024897 1:13375695-13375717 CCCCATCAAAATTATCAAAATGG + Intergenic
902238844 1:15074925-15074947 CATCATCACGGTCATCATCATGG - Intronic
903918270 1:26780261-26780283 CCTCAGCAAACTCAGCATCCAGG + Exonic
905928214 1:41767139-41767161 TCTCATCAAATGCATCATCTGGG + Intronic
907585025 1:55609341-55609363 CCTCAGGAAAATTACCATCATGG + Intergenic
908819097 1:68064723-68064745 CCTCAACTAAATCATATTCAAGG + Intergenic
910514104 1:88038229-88038251 CCTCAGGAAACTCATAATCATGG - Intergenic
911162952 1:94699935-94699957 TCTCATCCAAATCACCCTCACGG - Intergenic
911839969 1:102669568-102669590 CATCATCATCATCATCATAATGG + Intergenic
912194174 1:107378280-107378302 CCTCATCAGAAACATCCTCAAGG - Intronic
912611890 1:111055932-111055954 CCTCAGCAAAATCAGCATAAAGG - Intergenic
913333287 1:117684985-117685007 CATTATCATTATCATCATCATGG + Intergenic
916088810 1:161290967-161290989 CATCATCATCATCATCATCATGG + Intergenic
916170643 1:161999246-161999268 GCTCATCAAAAACACCATTAAGG + Intronic
916184634 1:162118901-162118923 CCTCAGAAAACTCATCAACAGGG + Intronic
917481303 1:175414553-175414575 CCTTATCAATATAATTATCATGG + Intronic
918041637 1:180917226-180917248 TGTCATCAAAATCATCAGGATGG + Intronic
918156893 1:181856427-181856449 CCTCATCATAATCATCAGAGAGG - Intergenic
918291743 1:183115031-183115053 ACTAAACAAAATCATCAACAAGG - Intronic
918843706 1:189581229-189581251 CATCATCATCATCATCATCAGGG - Intergenic
919252531 1:195075570-195075592 CATCATCATCATCATCATCCAGG - Intergenic
919879853 1:201894435-201894457 CCTCATCTGACTCATCATCTGGG + Intergenic
921265384 1:213417120-213417142 CCTCATCAACATCACCTCCACGG + Intergenic
923475977 1:234331708-234331730 CATCACCAGCATCATCATCACGG + Intergenic
923513468 1:234673888-234673910 CCACATAAAAATGATCAGCAAGG - Intergenic
1067749891 10:48963997-48964019 CCTCATCAAAAGCACCATCCTGG + Exonic
1068073837 10:52229439-52229461 CCTCCTCAAAGCCATCATGAGGG - Intronic
1069217672 10:65842456-65842478 CCTCAGCAAAGTTATAATCATGG + Intergenic
1069339691 10:67396378-67396400 CATCATCAAAATTATCATATTGG + Intronic
1070404977 10:76086455-76086477 CTTCATCAAACTCATCATTCAGG + Intronic
1070466319 10:76727273-76727295 CCTCAGAAAACTTATCATCATGG - Intergenic
1071352975 10:84765263-84765285 TCTCATCAAAATCTTCTCCATGG - Intergenic
1072784501 10:98270443-98270465 CATCACCATTATCATCATCATGG + Intergenic
1073298759 10:102457817-102457839 CTTCATCAAAACCACCATCTTGG - Intergenic
1073660044 10:105464946-105464968 CCTGATTAAAATTATCATCAAGG + Intergenic
1074491045 10:113939846-113939868 ACTCTTCACGATCATCATCATGG - Intergenic
1075035608 10:119064584-119064606 CCTCAGGAAAATTACCATCATGG - Intronic
1075439513 10:122468428-122468450 CATCATCATCATCATCTTCAAGG + Intronic
1076182392 10:128420457-128420479 CCTCAGGAAACTCATAATCATGG + Intergenic
1076706067 10:132302205-132302227 CCTCAACAAAATCACCTCCAAGG + Intronic
1079733433 11:23964115-23964137 CCTTTTCAAAATTATCATCCAGG + Intergenic
1080054999 11:27897784-27897806 CCTCAGGAAAATTATAATCATGG + Intergenic
1080627408 11:34043009-34043031 CCTCAGGAAACTTATCATCATGG + Intergenic
1081058121 11:38436540-38436562 TCTCATGAGAATCCTCATCATGG - Intergenic
1081329370 11:41785389-41785411 CATCATAAATATCATCATCAAGG + Intergenic
1082258700 11:50061149-50061171 GCTCTTCAAAATCAACATCTTGG - Intergenic
1082934049 11:58638390-58638412 CACCATCAGAATGATCATCATGG + Intergenic
1083858888 11:65408908-65408930 CCTCTTCAAAATCAGCATATCGG - Intronic
1084773331 11:71358231-71358253 CACCATCATCATCATCATCACGG + Intergenic
1085882808 11:80487791-80487813 TATCATCATCATCATCATCAGGG + Intergenic
1086772205 11:90780574-90780596 CCTCAGGAAAATTATAATCATGG + Intergenic
1087635883 11:100700505-100700527 CTTAATAAAAATCAGCATCAGGG - Intronic
1088133227 11:106521344-106521366 CCTCATTAAAATTTCCATCATGG - Intergenic
1088968691 11:114751914-114751936 CATCTTCAAAGCCATCATCATGG - Intergenic
1089842608 11:121431296-121431318 CCTCAGCAGAATCCTCTTCAGGG + Intergenic
1091785260 12:3239438-3239460 CCTCATTAACATGATCATGATGG + Intronic
1092010945 12:5112136-5112158 CATCATCAAAATGATCATACAGG + Intergenic
1092128297 12:6090641-6090663 CCTCCTCCTCATCATCATCATGG + Intronic
1092511356 12:9160207-9160229 TTTCATAAAAATTATCATCATGG + Intronic
1092837555 12:12505260-12505282 CCCCATGAATATCATCAGCAAGG - Intronic
1093315742 12:17647563-17647585 CCTCAGGAAACTTATCATCATGG - Intergenic
1094264169 12:28536756-28536778 TCTGATCAAAATCATCATTTAGG - Intronic
1094526314 12:31233601-31233623 CCTCATTAATATGATCATCATGG - Intergenic
1095308056 12:40661688-40661710 CCTCATGAAACTTATAATCATGG - Intergenic
1095576452 12:43745540-43745562 CCTCAGGAAATTCATAATCATGG - Intronic
1097501658 12:60410990-60411012 CCTCAGGAAAATTATAATCATGG + Intergenic
1097845131 12:64358491-64358513 CATCATCATCATCATCATCTTGG + Intronic
1098432496 12:70435129-70435151 CCTCACTAAAAACATCAGCAAGG + Intergenic
1098738641 12:74141562-74141584 CCTCAGGAAAATTATAATCATGG - Intergenic
1099290146 12:80766728-80766750 CATCATCATCATCATCATCTAGG + Intergenic
1102564905 12:113790216-113790238 CCTCAGCAAACTCACAATCATGG + Intergenic
1102888148 12:116537181-116537203 CCTCGTTATAATTATCATCATGG - Intergenic
1103677757 12:122669942-122669964 GATCATCATCATCATCATCACGG + Intergenic
1104535602 12:129615277-129615299 CCACAGCAACCTCATCATCAGGG + Intronic
1104581138 12:130011665-130011687 CCTCAGGAAACTCACCATCATGG + Intergenic
1108645864 13:52427186-52427208 CCTCAGCAAACTAATGATCAAGG - Exonic
1110372915 13:74759370-74759392 CCTCATCTAAAACAACACCAAGG - Intergenic
1110645010 13:77872636-77872658 CATCATCATCATCATCATCCTGG + Intergenic
1111064659 13:83074005-83074027 CCTCAGGAAAATTATAATCATGG - Intergenic
1111317952 13:86585598-86585620 CCTCAGGAAACTCATAATCATGG - Intergenic
1111496582 13:89058393-89058415 CCTCAAGAAAATAATCATCAAGG - Intergenic
1111499446 13:89096702-89096724 CCTCTTAAAAAGCATCATCAGGG - Intergenic
1112686393 13:101832715-101832737 ACTCTTCAATATCATTATCATGG - Intronic
1113073861 13:106448884-106448906 CCTCAGCAAACTTACCATCATGG - Intergenic
1113304910 13:109067093-109067115 CAGCATCACAGTCATCATCATGG + Intronic
1113444049 13:110352083-110352105 CATCATCATGATCATTATCAGGG - Intronic
1113673347 13:112190147-112190169 CCTCAGGAAACTTATCATCATGG - Intergenic
1116260579 14:42619815-42619837 CCTCAGGAAACTCACCATCATGG + Intergenic
1117560897 14:56937359-56937381 CATCATCATTACCATCATCAAGG - Intergenic
1118974726 14:70666845-70666867 CATCATCATCATCACCATCATGG - Intronic
1120178773 14:81322396-81322418 TCTAGGCAAAATCATCATCATGG + Intronic
1120255596 14:82115593-82115615 TCTCATGAAAATCATCCACAGGG - Intergenic
1121383329 14:93493783-93493805 CCTCAGAAAACTCATAATCATGG + Intronic
1122801514 14:104232594-104232616 CATCATCACCATCATCATCATGG + Intergenic
1124401789 15:29354934-29354956 CCTCATCAAGATCAGCCTCCAGG - Intronic
1125217363 15:37290650-37290672 CCTCACCAAAATTATCCTTAAGG + Intergenic
1125542878 15:40480995-40481017 CCCCATCAACATCATTATCCAGG - Intergenic
1126324055 15:47455979-47456001 CATCATCGCCATCATCATCATGG - Intronic
1127013014 15:54650690-54650712 CCTCAGGAAAATTACCATCATGG + Intergenic
1127648149 15:60978172-60978194 CATCATCACAATCATCAACATGG + Intronic
1127708902 15:61575697-61575719 CCACTTTATAATCATCATCATGG + Intergenic
1129257072 15:74339597-74339619 CCTCCTCAAAGCCAGCATCAAGG - Exonic
1130190389 15:81729714-81729736 CTTCATAAAATTCATCATGAGGG - Intergenic
1130885450 15:88089041-88089063 CATCATCATCATCTTCATCAAGG + Intronic
1132142847 15:99409333-99409355 GCTCATCAAAAGCATCACCCAGG + Intergenic
1132682305 16:1147876-1147898 CCTGATCAACATGATCAACACGG - Intergenic
1133438022 16:5796564-5796586 CACCATCATCATCATCATCAGGG - Intergenic
1133589049 16:7225109-7225131 GCTTATCATCATCATCATCACGG + Intronic
1135409919 16:22225795-22225817 CCCCATCAGAATCACCATCATGG - Exonic
1135748288 16:25036164-25036186 CAACATCATCATCATCATCATGG + Intergenic
1135907482 16:26526090-26526112 CACCATCATCATCATCATCATGG + Intergenic
1136475579 16:30511113-30511135 CCCCATCAACATCCTCATCCAGG + Exonic
1137801766 16:51268040-51268062 CCTCAGGAAACTCATAATCATGG + Intergenic
1138118345 16:54378172-54378194 CATCATGACTATCATCATCATGG + Intergenic
1138954192 16:61951103-61951125 CATCATCATCATCATCATCATGG + Intronic
1139441844 16:66972244-66972266 CATCATCATCATCATCATCATGG + Intronic
1140549809 16:75853238-75853260 CCTCATGAAATTCTCCATCAAGG - Intergenic
1141497874 16:84422488-84422510 CCTCAGCAACATCGTCTTCATGG + Exonic
1141872767 16:86799635-86799657 CCTCCTCATCGTCATCATCAAGG + Intergenic
1142375315 16:89703662-89703684 CCTCAGCAAACTCACAATCATGG - Intergenic
1142704631 17:1686911-1686933 CTTCATCATCATCATCGTCATGG + Intergenic
1142883796 17:2900364-2900386 AATCATCATCATCATCATCATGG + Intronic
1143754462 17:9056365-9056387 CCCCATCAAAACCATCAAGATGG - Intronic
1144022512 17:11249942-11249964 CCTCTTCAAAATGATCATCGTGG - Intronic
1144170332 17:12653763-12653785 CGTCATCAACATCATCATCATGG + Intergenic
1144423444 17:15118677-15118699 AATCATCATCATCATCATCACGG + Intergenic
1146821694 17:35987984-35988006 CCTCATCTGAATCATCAGGATGG + Intronic
1149009038 17:51835980-51836002 CATCATCAACACCATTATCATGG - Intronic
1151230946 17:72684656-72684678 ACTCACCAAAGTCATAATCATGG - Intronic
1151321066 17:73352596-73352618 CCTCATCAAAGACATCCCCAAGG - Exonic
1151431948 17:74069727-74069749 CCTCATTAAAGTCATGAGCAGGG + Intergenic
1152025773 17:77808210-77808232 CATCATCATCATCATCATTAGGG - Intergenic
1152371987 17:79894404-79894426 CCTCATCAAAATCATCATCATGG + Intergenic
1153182935 18:2456259-2456281 CCTCAGGAAACTCATAATCATGG + Intergenic
1153208876 18:2736651-2736673 CAACATCATAATCATAATCATGG + Intronic
1157201804 18:45665807-45665829 CCTCATCTAAAAAATTATCAAGG + Intronic
1158071026 18:53470652-53470674 CCTCATGAAACTCAGAATCATGG + Intronic
1158259284 18:55589697-55589719 CCTCCTCATCATCATCACCATGG + Intronic
1159043873 18:63349960-63349982 CCTGATCTAAATCATCAACCAGG + Intronic
1159352391 18:67292980-67293002 CATCATCATCATCATCATCTTGG - Intergenic
1159414450 18:68125833-68125855 CCGCATCACCAGCATCATCAAGG - Intergenic
1159755445 18:72358409-72358431 CATCATCATAATCATCAACAAGG + Intergenic
1159852722 18:73545508-73545530 CATTATCATCATCATCATCATGG - Intergenic
1160018315 18:75160870-75160892 CCTCATCATACTCATCATGATGG - Intergenic
1161044858 19:2129317-2129339 CCTCATCAAGATCATCAAGCTGG - Exonic
1161899456 19:7107439-7107461 CATCATCACCATCATTATCACGG - Intergenic
1162190430 19:8941486-8941508 CATCAACATAATCACCATCATGG - Intronic
1162195234 19:8979582-8979604 GCACCTCAAAAGCATCATCATGG - Exonic
1164025996 19:21353216-21353238 CCTCAGCAAAATCAGCATAGAGG - Intergenic
1165738447 19:38192253-38192275 CCTGAAGAAACTCATCATCATGG + Exonic
1166618519 19:44273315-44273337 GCTCATCAACATGATGATCATGG + Exonic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
1167527089 19:49991091-49991113 CCACATAAAAATGACCATCATGG - Intronic
1168291246 19:55358755-55358777 CCTCACCAAGCTCATGATCACGG - Exonic
1202646419 1_KI270706v1_random:146067-146089 CCTCATCACTTTCATCACCAAGG - Intergenic
925679945 2:6409795-6409817 ACTCAGAAAAATCATCATAAGGG - Intergenic
926572137 2:14541476-14541498 GCTCATCTAAATGCTCATCATGG + Intergenic
927658479 2:24971838-24971860 CCGCATCAAAGTCATCTCCATGG - Exonic
928078851 2:28290401-28290423 TATCATCATCATCATCATCAGGG + Intronic
929437416 2:41939198-41939220 CCTCTTCCTCATCATCATCATGG + Intronic
930341913 2:50127532-50127554 CCTCTTTCACATCATCATCAGGG + Intronic
931144598 2:59503412-59503434 ACTGCTCAAAATCATCATCAAGG + Intergenic
932718748 2:74122992-74123014 CCTTATCAAATTCATTATCAAGG - Intergenic
935382599 2:102467706-102467728 CATCATCACCATCATCATCGTGG + Intergenic
935554164 2:104489497-104489519 CATAATCAAAAACATCTTCATGG + Intergenic
937031904 2:118747747-118747769 CCTCACCATCAGCATCATCATGG - Intergenic
937664902 2:124475384-124475406 CCTCATGAAACTCATTATTAGGG - Intronic
937765176 2:125652624-125652646 CCTCATCAATATCAGCCTCAGGG - Intergenic
938852902 2:135280102-135280124 CCTCATAATAATCAGCATCTTGG + Intronic
940634111 2:156276502-156276524 CCTCTTCAATATAACCATCAAGG + Intergenic
941130195 2:161638736-161638758 ATTCTTCCAAATCATCATCATGG + Intronic
941994686 2:171591215-171591237 CCTCAGGAAACTTATCATCATGG - Intergenic
942644719 2:178097347-178097369 CCTCAGGAAACTCATAATCATGG + Intronic
944706783 2:202297417-202297439 CCTCACCAAAAGCATCATAACGG - Exonic
944978266 2:205083436-205083458 ACTTATAAAAATCAACATCATGG + Intronic
945606342 2:211937582-211937604 CCTCATGAAACTCACAATCATGG + Intronic
946267025 2:218554203-218554225 CCTCATCAACATTATAATGAAGG - Intronic
946824378 2:223661620-223661642 CCTCAGCAAAATCAGCATAAAGG + Intergenic
946884220 2:224206902-224206924 CCTCATGAAACTTACCATCATGG - Intergenic
947016845 2:225630394-225630416 CATCATGAAAACAATCATCAAGG - Intronic
947457406 2:230267876-230267898 CCTCATCAAAACCTTCATGAGGG - Intronic
1170284216 20:14687760-14687782 CCTCATAAAAGTCATAAACATGG + Intronic
1171157934 20:22893640-22893662 CCTCAGAAAACTTATCATCATGG - Intergenic
1172481240 20:35272958-35272980 CATCATCATTGTCATCATCATGG + Intronic
1173134918 20:40431220-40431242 CCAAATCAAATTCATCATCAAGG - Intergenic
1173280153 20:41619764-41619786 CCTCTGCTAAATCATTATCATGG - Intergenic
1173406661 20:42772110-42772132 CCTCATCAACATCGTCACCCAGG - Intronic
1173842909 20:46170335-46170357 CATCATCATCATCATTATCATGG - Intergenic
1173985947 20:47261577-47261599 CATCATCATCATCATCATCCAGG + Intronic
1174031728 20:47633906-47633928 CTGCACCAAAATCATCAACAGGG - Intronic
1174363323 20:50041734-50041756 CATCATCATCATGATCATCAAGG - Intergenic
1175127199 20:56761306-56761328 CCTCACCATCATCATCACCATGG - Intergenic
1175616915 20:60407524-60407546 CATCATCATCATCATCACCATGG - Intergenic
1175877229 20:62236167-62236189 CATCATCATCCTCATCATCATGG + Intronic
1176130763 20:63495867-63495889 CTTCATCAAGAACATGATCACGG - Exonic
1176741704 21:10610008-10610030 CCTCAACAGACTCAGCATCAAGG - Intergenic
1176878577 21:14163616-14163638 AATCATCATAATGATCATCATGG + Intronic
1177447485 21:21216748-21216770 CCTCATTCAAATCCTCACCAAGG - Intronic
1179280979 21:39934024-39934046 CCACTTCAATATCATCATCTTGG + Intergenic
1179331231 21:40403938-40403960 CATCATCATGATCACCATCATGG + Intronic
1181656331 22:24302927-24302949 CATCATCATCATCATCATCGTGG - Intronic
1181939455 22:26464141-26464163 CCCCATCAACATCCTCATCCAGG + Exonic
1182329498 22:29540914-29540936 CCTCTCAAAAATCAGCATCAGGG + Intronic
1182942179 22:34287317-34287339 CATTATCAAAATAATCTTCAAGG + Intergenic
1183382680 22:37498308-37498330 CGTCACCAAAATCCCCATCATGG + Intronic
1183530490 22:38350874-38350896 CATCATCATCATCACCATCATGG - Intronic
1183978217 22:41525339-41525361 CCTCATCAAGGTCAGCAGCATGG + Exonic
949339345 3:3011876-3011898 CATCATCACCATCATCATCATGG - Intronic
949712975 3:6892978-6893000 CATCATTATCATCATCATCAAGG - Intronic
950870049 3:16220490-16220512 TCTCTTCAAAATTTTCATCATGG + Intronic
951091970 3:18584690-18584712 CCTCAGCAAGATCATCAAGATGG + Intergenic
951424380 3:22526335-22526357 TCTCATCATGATCATCATTAAGG - Intergenic
951702285 3:25508565-25508587 TTACATAAAAATCATCATCAGGG + Intronic
952971156 3:38651104-38651126 CCTCTTCAAGATCCCCATCATGG - Intergenic
954183907 3:48902272-48902294 AATCATCATCATCATCATCAGGG + Intergenic
955420699 3:58734190-58734212 CCTCATGAAACTTATAATCATGG - Intronic
955512202 3:59692507-59692529 GCTAATCATAATCAGCATCAAGG + Intergenic
956030591 3:65033165-65033187 CACCATCACAATCATCATCGTGG - Intergenic
957068191 3:75543791-75543813 CTTAATGAAATTCATCATCAGGG + Intergenic
957173332 3:76769348-76769370 CATCATCATCATCATCATCTGGG - Intronic
957261461 3:77907454-77907476 TCTCAACATCATCATCATCAGGG + Intergenic
957299197 3:78368938-78368960 CCTTATCAAAACCTTAATCAAGG + Intergenic
957661043 3:83154058-83154080 CCTCATGAAAATCAACATACTGG - Intergenic
958120596 3:89282858-89282880 CATGATCAAAATAATCATCATGG - Intronic
958537808 3:95426340-95426362 CCTCAGGAAACTTATCATCATGG + Intergenic
958737556 3:98026631-98026653 CATCATCATCATCATCATCGTGG + Intronic
958887296 3:99740442-99740464 CCTCATAAAACTTACCATCATGG + Intronic
959698034 3:109271008-109271030 CATCATCATCATCATCATCTAGG + Intergenic
959826261 3:110800101-110800123 ACTTATCATCATCATCATCAAGG - Intergenic
963832842 3:150026889-150026911 CCTCAGCAAAATTGACATCAAGG + Intronic
964059845 3:152507942-152507964 CCTCTTCAAAGTCACCTTCAAGG + Intergenic
964202063 3:154128699-154128721 CTTCATCAGAGTCAACATCAAGG + Intronic
965249879 3:166329206-166329228 CCTCAGGAAATTTATCATCATGG + Intergenic
966223648 3:177574839-177574861 CATCATCAACAGCACCATCAAGG - Intergenic
967185992 3:186945145-186945167 CCTAATGAAAATCATCAGCTGGG + Intronic
967294528 3:187952188-187952210 ACTCACCCAAATCACCATCAGGG + Intergenic
967801279 3:193663495-193663517 CCTCAAAAAAAGCATCATGAAGG - Intronic
969224060 4:5782907-5782929 TCTCCTCAAAACCATCATTAGGG - Intronic
970152053 4:13100520-13100542 CATCATCAAACTCCTTATCATGG - Intergenic
971241687 4:24895051-24895073 ACTCATCATCATCACCATCATGG - Intronic
971279107 4:25226648-25226670 TCTCATCGAAATCTTCATGAAGG + Intronic
971713813 4:30150482-30150504 CCCAATCAAAATGAGCATCATGG + Intergenic
971787306 4:31120943-31120965 CATTACCATAATCATCATCATGG - Intronic
972297823 4:37757029-37757051 CCTCAGGAAACTCATAATCATGG - Intergenic
974506880 4:62786449-62786471 CCTTATCATCATCCTCATCATGG - Intergenic
974595173 4:64004692-64004714 CCTCAGCAAATTTATAATCATGG - Intergenic
977378465 4:96238390-96238412 CCTCAGGAAACTTATCATCATGG - Intergenic
978251608 4:106637592-106637614 CCTCAGGAAAATCACAATCATGG - Intergenic
978858170 4:113417117-113417139 TCTCATCAAAATCAGCATACAGG - Intergenic
979068772 4:116173439-116173461 CCTCAACAAATTAAGCATCAAGG - Intergenic
979440891 4:120748787-120748809 CCTCAGCAAACTCACCCTCAGGG - Intronic
979625831 4:122844384-122844406 CCCCCTCAAAGTCATCATGAGGG + Intronic
983320006 4:166184574-166184596 CCTCAGCAAACTTATAATCATGG - Intergenic
983487590 4:168350459-168350481 CCTCAGGAAACTTATCATCATGG - Intergenic
983830644 4:172322568-172322590 CCTCAGGAAACTCATAATCATGG + Intronic
983942702 4:173552623-173552645 TCTCATGAAATTCATGATCATGG - Intergenic
984072162 4:175128692-175128714 CCTCATCAAAATTAGCCACAAGG + Intergenic
985107949 4:186516956-186516978 CCTCAGCAAAATCAACATAGAGG - Intronic
986510164 5:8496552-8496574 CCTCAGCAAAGTTATAATCATGG + Intergenic
987352588 5:17034378-17034400 CCTCAGGAAATTTATCATCATGG - Intergenic
988488927 5:31690885-31690907 GGTCATCATCATCATCATCATGG - Intronic
988505897 5:31822818-31822840 CCCCATCAACATCATTATCCAGG - Intronic
988917353 5:35908288-35908310 GCTGTTCATAATCATCATCAGGG - Intronic
990760853 5:59127709-59127731 CGTCAGCAGAGTCATCATCAGGG - Intronic
993326192 5:86540365-86540387 CCTGATCAAAATCATCATAAGGG - Intergenic
993468423 5:88276493-88276515 CCTTATCAAATTTAACATCAAGG + Intergenic
993520600 5:88894990-88895012 TCTCGGCAAAATCATTATCATGG - Intronic
993887326 5:93430873-93430895 CATCATCATCATCATCATCATGG + Intergenic
996917018 5:128724034-128724056 CCTCAGGAAATTCATAATCATGG - Intronic
997944211 5:138184625-138184647 CATTTTCAATATCATCATCAAGG - Exonic
998193307 5:140044508-140044530 CCTCATCCAATTAATCACCAAGG + Intergenic
999078317 5:148818487-148818509 CATCATCATTATCATCATCTTGG - Intergenic
999179529 5:149659321-149659343 CCTCATCACTATCATCATATGGG + Intergenic
999718092 5:154378329-154378351 CATCATCATCATCATTATCACGG + Intronic
1000098249 5:157989864-157989886 GCTCCTCAACACCATCATCAAGG - Intergenic
1000447158 5:161336268-161336290 CCCAATCATAATCATAATCAAGG + Intronic
1001339981 5:170834214-170834236 CATCATCATGATCATCATCTGGG + Intergenic
1001664036 5:173417708-173417730 CCTCATCATCAACATCATCAGGG + Intergenic
1001723720 5:173878265-173878287 CATGATCAAAGTCAGCATCAGGG - Intergenic
1002336065 5:178479096-178479118 CATCATCATCATCATCATGAGGG - Intronic
1002371156 5:178755988-178756010 CTTCATCATGATCATCATCTGGG - Intergenic
1002482198 5:179509900-179509922 CATCATCATCATCATCATCTGGG - Intergenic
1002591864 5:180296004-180296026 CCTCATTCTAATCATCACCATGG - Intergenic
1003122800 6:3331501-3331523 ACTCATCAAAGTCCACATCATGG + Intronic
1003311045 6:4970309-4970331 CATCATCATCATCATCACCAGGG - Intergenic
1003681177 6:8258755-8258777 CATCATCATCATCATCATTATGG + Intergenic
1003964889 6:11243328-11243350 GATCATCATCATCATCATCAAGG - Intronic
1004240098 6:13913477-13913499 CATCATCATCATCATCAACAGGG - Intergenic
1004609070 6:17221837-17221859 CCTCAGCATAAGCATCAGCAGGG - Intergenic
1005864729 6:29928765-29928787 CCCCATCATCATAATCATCAAGG - Intergenic
1006334418 6:33413087-33413109 CCTCATCAAGACCATGGTCAGGG + Intronic
1007973628 6:46077969-46077991 CATCACCATGATCATCATCATGG - Intronic
1008862810 6:56170605-56170627 CCCCATGAATATCATAATCATGG + Intronic
1009780849 6:68267457-68267479 CCTCAGGAAACTCATAATCATGG - Intergenic
1010371204 6:75109917-75109939 ACTTTTCAAAGTCATCATCAAGG - Intronic
1011202664 6:84854549-84854571 CCTCATCGAAACCAGCATCTTGG + Intergenic
1012185162 6:96205244-96205266 CCTAAATAAAATTATCATCAAGG + Exonic
1012688902 6:102289646-102289668 CCTAATCAAAATCATGGGCATGG - Intergenic
1012871834 6:104682267-104682289 CACCATCATAATCATCATCTGGG - Intergenic
1013657922 6:112264695-112264717 CCTAACCCAAGTCATCATCATGG - Intergenic
1013875868 6:114827169-114827191 GCTCATCAAAGGCATAATCAAGG - Intergenic
1016149940 6:140728300-140728322 CCTCAACAAACTCACAATCATGG + Intergenic
1016716073 6:147230930-147230952 CATCATCACCAGCATCATCACGG - Intronic
1019975067 7:4574524-4574546 CCTCAGGAAACTCATAATCATGG - Intergenic
1020038950 7:4986722-4986744 TATCATCATCATCATCATCATGG + Intronic
1020140641 7:5609689-5609711 CCTCTTCCAATTCATTATCAGGG + Intergenic
1020281244 7:6651196-6651218 CATCATCATCATCATCATCTGGG + Intronic
1020588299 7:10101219-10101241 CTTCATCATAACCATCAGCAAGG + Intergenic
1020743641 7:12053925-12053947 GCTCATGAAGATCATCACCATGG + Intergenic
1022273705 7:28835610-28835632 CCTCTGCAAAATCCTTATCAGGG - Intergenic
1022375957 7:29811250-29811272 CATCATCATCATCATCATAATGG - Intronic
1023291020 7:38669163-38669185 CCTCAGGAAAATTATGATCATGG - Intergenic
1024537851 7:50452765-50452787 CATCATCAAAATTTTCATGATGG + Intronic
1025108800 7:56195299-56195321 CCTCATTATCACCATCATCATGG + Intergenic
1025174954 7:56794661-56794683 GCTCTTCAAAATCAACATCTTGG - Intergenic
1025640893 7:63367646-63367668 CCCCATGAACCTCATCATCAGGG - Intergenic
1025696849 7:63781754-63781776 GCTCTTCAAAATCAACATCTTGG + Intergenic
1025975553 7:66366802-66366824 GCTCTTCAAAATCAACATCTTGG - Intronic
1026237107 7:68536354-68536376 CCTCATCAAAATAATTAAAATGG + Intergenic
1028646522 7:93103688-93103710 GTTCTTCAAAATCATCAACAAGG + Exonic
1029465034 7:100720268-100720290 CCCCATCAAATTCCTCAACATGG + Intergenic
1031013343 7:116546769-116546791 CCTCACCAAAATGAACCTCAGGG - Intronic
1031357704 7:120808015-120808037 CTTCATAAAAATCATAAACAAGG + Intronic
1031461766 7:122059845-122059867 CCTCATCAGATTGATCATCTTGG - Exonic
1031719843 7:125160172-125160194 CATCATCATCATCTTCATCATGG + Intergenic
1032061162 7:128726574-128726596 CCTCAGCAAAATCAGCAGCATGG + Intronic
1032162159 7:129519271-129519293 AATCATCATCATCATCATCAAGG - Intergenic
1032803339 7:135334005-135334027 CCCCATGAAAATCACAATCAAGG - Intergenic
1033852789 7:145517588-145517610 CCTCAGGAAAATCACAATCATGG + Intergenic
1034969807 7:155411839-155411861 CATCATCATCACCATCATCATGG + Intergenic
1035390236 7:158499166-158499188 TATCATCATCATCATCATCATGG + Intronic
1037400001 8:18486152-18486174 CATCATCATCATCATCATCATGG + Intergenic
1037656841 8:20891339-20891361 CATCATCATCATCATCACCAAGG + Intergenic
1037904752 8:22709577-22709599 CATCATCAATATCATCACCCTGG + Intergenic
1038075693 8:24070944-24070966 CACCATCATCATCATCATCATGG + Intergenic
1039065286 8:33602302-33602324 ACTCATGAAAATGATCCTCACGG - Intergenic
1041591562 8:59591579-59591601 CCACATCATCATCATCATAAAGG + Intergenic
1043390828 8:79790234-79790256 CCTCAGGAAACTTATCATCATGG + Intergenic
1043470941 8:80561760-80561782 CCTCTTCAAAATGAGCATTAAGG - Intergenic
1044626831 8:94242230-94242252 CCTCATCAACATCATCATCTCGG + Intergenic
1044948463 8:97413313-97413335 CCTCATCCAAATAATAAGCATGG - Intergenic
1045032566 8:98151650-98151672 CCTCATGAAGCTCACCATCAAGG - Intronic
1045066976 8:98457055-98457077 CACCTTCAAAGTCATCATCATGG - Intronic
1045812650 8:106241529-106241551 CATCATCATCATCATCATCAAGG + Intergenic
1048622690 8:136152201-136152223 CCTCAGGAAACTCATAATCATGG + Intergenic
1049681571 8:143920937-143920959 GATCATCAAGATCATCATCACGG - Exonic
1049774034 8:144396514-144396536 CCTCATCCACAGCATCCTCACGG - Intronic
1054713563 9:68535596-68535618 CATCATCAATATAATGATCAGGG + Intergenic
1054801250 9:69351386-69351408 CATCATCATCATCATCATCAAGG - Intronic
1054895317 9:70303490-70303512 CCACATGAAAACCATCATCCAGG - Intronic
1055879273 9:80979226-80979248 CTTCATCTAATTTATCATCAGGG + Intergenic
1055902008 9:81250821-81250843 CTTGTTCATAATCATCATCATGG - Intergenic
1056431382 9:86531737-86531759 CTTGATCAAAATCATCAAGAAGG - Intergenic
1056586617 9:87931696-87931718 CCTCATCACTATCACCACCAGGG + Intergenic
1056610259 9:88121246-88121268 CCTCATCACTATCACCACCAGGG - Intergenic
1056848213 9:90058681-90058703 CCTCATCATGACCACCATCATGG - Intergenic
1056924934 9:90826379-90826401 CCTCATCACCTTCATCATCATGG + Intronic
1057162088 9:92896081-92896103 CCTCATCACTATCACCACCAGGG + Intergenic
1057723143 9:97548797-97548819 CGTCATCATCATCATCATCTTGG + Intronic
1059134611 9:111793817-111793839 CATCATCATCATCATCATCTTGG - Intronic
1059465196 9:114464812-114464834 CATCATCATCATCATCATTATGG - Intronic
1060672691 9:125483863-125483885 CATCATCATCATCATCATCATGG - Intronic
1060974654 9:127757599-127757621 CATCATCATCATCATCATCTGGG - Intronic
1061073902 9:128329038-128329060 TCTCACCAAAATCAGCCTCAGGG - Intronic
1061704196 9:132439988-132440010 CATCATCAACATCAGCATAATGG + Intronic
1185844696 X:3427073-3427095 AATCATCATTATCATCATCATGG - Intergenic
1185928694 X:4175780-4175802 ACTCATCATAACTATCATCAAGG + Intergenic
1185931936 X:4213107-4213129 CCTCATAAAAGTCACAATCATGG - Intergenic
1185950922 X:4433015-4433037 CCTCGTGAAGATAATCATCAGGG - Intergenic
1186079583 X:5916065-5916087 CACCATCAACATCATCATGATGG + Intronic
1186688942 X:11954484-11954506 CCACTTAAAAATAATCATCATGG + Intergenic
1186783650 X:12939375-12939397 CATCATCATCATCATCATCTTGG + Intergenic
1186807699 X:13156286-13156308 CATCATCATCATCATCATGATGG - Intergenic
1187843044 X:23508622-23508644 CCTCATGAAACTTATAATCATGG - Intergenic
1188351178 X:29132824-29132846 ACTCAGCAAAATCATTATAATGG - Intronic
1188547247 X:31321735-31321757 CCTTATCAATACCATCACCATGG + Intronic
1188859702 X:35242776-35242798 CCTCATGAAACTTATGATCATGG - Intergenic
1188865067 X:35304521-35304543 CCTCAAGAAAATTATCGTCAAGG - Intergenic
1188986015 X:36768989-36769011 CCTCTGCAAAATTATCTTCAAGG + Intergenic
1189343893 X:40225759-40225781 CCTGATCAAAATCATATTCCTGG + Intergenic
1189711991 X:43822889-43822911 CACCATCATCATCATCATCATGG + Intronic
1190938411 X:55017415-55017437 CATCATCATCATGATCATCATGG + Intronic
1192993647 X:76488743-76488765 CCTCAGCAAAATCAGCATAGAGG - Intergenic
1193382052 X:80827364-80827386 CAACATCAATATCAACATCAAGG - Intergenic
1194135120 X:90131364-90131386 CCTCATGAAACTCACAATCATGG - Intergenic
1194315178 X:92368691-92368713 CAACATCAAAATCAACATAAAGG - Intronic
1195237415 X:102915121-102915143 CCTCAGCAAAATCGGCATAAAGG + Intergenic
1195272794 X:103249978-103250000 CATCATCATCATCATCATCAAGG - Intergenic
1196315003 X:114211900-114211922 CCTCATGAAACTTATAATCATGG + Intergenic
1196500508 X:116375699-116375721 CCTCATCTACATTATCAACAGGG + Intergenic
1196760130 X:119193459-119193481 CCTCCTCCTCATCATCATCATGG - Intergenic
1196935146 X:120722786-120722808 CCTCAGCAAAATCAGCATATAGG - Intergenic
1197461866 X:126752427-126752449 CATCATCATCATCTTCATCATGG + Intergenic
1197724975 X:129770170-129770192 CATCACCATCATCATCATCATGG + Intergenic
1198035132 X:132794552-132794574 CATCATCATCATCATCATCCAGG - Intronic
1199152094 X:144499173-144499195 CCTCAGGAAACTCATAATCATGG + Intergenic
1199656269 X:149998287-149998309 CCTCATGAAACTTACCATCATGG + Intergenic
1199728627 X:150608801-150608823 CATCATCATCATCATCATCCTGG - Intronic
1200480903 Y:3701456-3701478 CCTCATGAAACTCACAATCATGG - Intergenic
1200623229 Y:5480227-5480249 CAACATCAAAATCAACATAAAGG - Intronic
1201962822 Y:19700770-19700792 CCTTATGAGAATCATCCTCATGG - Intergenic