ID: 1152373471

View in Genome Browser
Species Human (GRCh38)
Location 17:79905100-79905122
Sequence GTGTATGCACAGTCTTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152373468_1152373471 -3 Left 1152373468 17:79905080-79905102 CCCCAAGGATGCAACACTTTGTG No data
Right 1152373471 17:79905100-79905122 GTGTATGCACAGTCTTAGCTAGG No data
1152373470_1152373471 -5 Left 1152373470 17:79905082-79905104 CCAAGGATGCAACACTTTGTGTA No data
Right 1152373471 17:79905100-79905122 GTGTATGCACAGTCTTAGCTAGG No data
1152373469_1152373471 -4 Left 1152373469 17:79905081-79905103 CCCAAGGATGCAACACTTTGTGT No data
Right 1152373471 17:79905100-79905122 GTGTATGCACAGTCTTAGCTAGG No data
1152373466_1152373471 6 Left 1152373466 17:79905071-79905093 CCGCGGCTCCCCCAAGGATGCAA No data
Right 1152373471 17:79905100-79905122 GTGTATGCACAGTCTTAGCTAGG No data
1152373467_1152373471 -2 Left 1152373467 17:79905079-79905101 CCCCCAAGGATGCAACACTTTGT No data
Right 1152373471 17:79905100-79905122 GTGTATGCACAGTCTTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152373471 Original CRISPR GTGTATGCACAGTCTTAGCT AGG Intergenic
No off target data available for this crispr