ID: 1152375923

View in Genome Browser
Species Human (GRCh38)
Location 17:79919028-79919050
Sequence GAAGCCAGGGAGCCACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 7, 3: 30, 4: 250}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152375923_1152375930 -5 Left 1152375923 17:79919028-79919050 CCAGCATGTGGCTCCCTGGCTTC 0: 1
1: 0
2: 7
3: 30
4: 250
Right 1152375930 17:79919046-79919068 GCTTCTGGCCACGGCTGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 200
1152375923_1152375934 15 Left 1152375923 17:79919028-79919050 CCAGCATGTGGCTCCCTGGCTTC 0: 1
1: 0
2: 7
3: 30
4: 250
Right 1152375934 17:79919066-79919088 GGGTCCCCTGTGGCAGGAGCTGG 0: 1
1: 1
2: 3
3: 33
4: 421
1152375923_1152375927 -10 Left 1152375923 17:79919028-79919050 CCAGCATGTGGCTCCCTGGCTTC 0: 1
1: 0
2: 7
3: 30
4: 250
Right 1152375927 17:79919041-79919063 CCCTGGCTTCTGGCCACGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 266
1152375923_1152375929 -6 Left 1152375923 17:79919028-79919050 CCAGCATGTGGCTCCCTGGCTTC 0: 1
1: 0
2: 7
3: 30
4: 250
Right 1152375929 17:79919045-79919067 GGCTTCTGGCCACGGCTGGCTGG 0: 1
1: 0
2: 2
3: 19
4: 193
1152375923_1152375932 5 Left 1152375923 17:79919028-79919050 CCAGCATGTGGCTCCCTGGCTTC 0: 1
1: 0
2: 7
3: 30
4: 250
Right 1152375932 17:79919056-79919078 ACGGCTGGCTGGGTCCCCTGTGG 0: 1
1: 0
2: 1
3: 15
4: 190
1152375923_1152375933 9 Left 1152375923 17:79919028-79919050 CCAGCATGTGGCTCCCTGGCTTC 0: 1
1: 0
2: 7
3: 30
4: 250
Right 1152375933 17:79919060-79919082 CTGGCTGGGTCCCCTGTGGCAGG 0: 1
1: 0
2: 2
3: 36
4: 409
1152375923_1152375938 24 Left 1152375923 17:79919028-79919050 CCAGCATGTGGCTCCCTGGCTTC 0: 1
1: 0
2: 7
3: 30
4: 250
Right 1152375938 17:79919075-79919097 GTGGCAGGAGCTGGCCATCCTGG 0: 1
1: 1
2: 0
3: 29
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152375923 Original CRISPR GAAGCCAGGGAGCCACATGC TGG (reversed) Intergenic
900600601 1:3501199-3501221 GAAGCCAGGGAGGCACAGGCAGG + Exonic
900951775 1:5862095-5862117 GAGTCCAGGAAGCCACATGTGGG - Intergenic
901532663 1:9863431-9863453 GAAGCCTCCAAGCCACATGCGGG + Intronic
901866383 1:12109650-12109672 AAAGCCAGGGAGTCACCTGGAGG - Exonic
903162364 1:21498155-21498177 CTAGGCTGGGAGCCACATGCTGG + Intergenic
903164112 1:21509240-21509262 GAGGCCAGGGCGCCCCCTGCCGG - Intergenic
903672208 1:25043197-25043219 GAAGGCAGGGAGCCCCTTCCTGG + Intergenic
906689548 1:47783599-47783621 GAAGCCAGGGTCCCACATAAAGG + Intronic
906706456 1:47898478-47898500 GAAGCCAGGGAGGCACTGGGTGG + Intronic
907161057 1:52369193-52369215 ACAGCCAACGAGCCACATGCAGG + Intergenic
907251118 1:53140545-53140567 GAAGCCAGGCAGCCAGCAGCGGG + Intronic
909350807 1:74651319-74651341 GAAACCAAGGTGCCACATGAGGG + Intronic
911247800 1:95538056-95538078 GAAGCCAGGGACCCTCGTGGTGG + Intergenic
912375900 1:109209773-109209795 GAAGGAAGGGAGCCACAAGAAGG + Intergenic
916210265 1:162354582-162354604 GAAGCCAGGAAGACGCCTGCAGG - Intronic
916739002 1:167631873-167631895 GAAGTCAGGGAGCTATATTCAGG + Intronic
923199993 1:231702445-231702467 GAAGTCAGAGAGCCCCATGAAGG - Intronic
924184242 1:241470891-241470913 TAAGCCAGTGAGCCACATTTAGG - Intergenic
924519484 1:244793954-244793976 GAAGCCAGGGAGCCACCTGGAGG + Intergenic
1063367271 10:5498970-5498992 GCAGCCAGGGGGACACAGGCGGG + Exonic
1064440189 10:15346446-15346468 GAAGAGATGGAGCCACAGGCAGG + Intronic
1067186305 10:44030796-44030818 GAAGCCAGGCAGCCAAATGATGG - Intergenic
1070580477 10:77715277-77715299 TAAGCCAGGGGGCCACCTGGTGG - Intergenic
1071300732 10:84254142-84254164 GGAGCCAGGGAGCTACAAGGAGG - Intronic
1072637128 10:97185443-97185465 GGAGCCAGGGAGCCAGGGGCGGG + Intronic
1073216632 10:101840132-101840154 GAGGCCAGGCAGGCACATGTGGG + Intronic
1073354760 10:102845119-102845141 GAAGTCAGGGACCCAAATGGAGG - Intergenic
1073859404 10:107720350-107720372 GAAGGCAGGGAGGACCATGCAGG + Intergenic
1074096599 10:110318719-110318741 TCAGCCAGGGATCCACATACAGG + Intergenic
1074417718 10:113281948-113281970 GAAGGCAGGGAGTCACATAAGGG + Intergenic
1075398323 10:122143430-122143452 GAAGCCGGGGAGCCAAGTGCTGG + Intronic
1075423594 10:122324818-122324840 GAAGCCAAGAAGCAACATGGCGG - Intronic
1075455482 10:122582217-122582239 GAAGGCAGAGAGGCCCATGCAGG + Intronic
1075456534 10:122588577-122588599 GAAGCCAGGGAGGACCATGGGGG + Intronic
1075457605 10:122594920-122594942 GAAGGCAGAGAGGCCCATGCAGG + Intronic
1075515171 10:123102811-123102833 GAAGCTAGGGAGCCAAAGGCAGG - Intergenic
1075546886 10:123361957-123361979 AAAGCCAGGGAAACAGATGCTGG + Intergenic
1076658465 10:132039564-132039586 GAAGCCAGTGAGCCACAGGCAGG - Intergenic
1076679084 10:132162262-132162284 GAAGGCAGGGAGGCTCATCCAGG + Intronic
1076883605 10:133251558-133251580 GAAGCCTGGGGTCCACCTGCGGG - Intergenic
1077898355 11:6471012-6471034 GAGGACAGGAAGCCAGATGCAGG + Intronic
1078391476 11:10938840-10938862 GAAGCCCGGGAGTCCCAGGCAGG - Intergenic
1080653254 11:34239361-34239383 GGAGACAGGGTGCCCCATGCTGG + Intronic
1081004372 11:37716530-37716552 CAAGCCAGGGATCTATATGCAGG + Intergenic
1081468329 11:43345914-43345936 GCAGCCAGTTAGCCTCATGCAGG + Intergenic
1081701086 11:45153265-45153287 GGAGCCAGGGAGCCAGCTGGTGG + Intronic
1083347440 11:62003410-62003432 GAACCCAGGGAACCCCAGGCTGG + Intergenic
1083904182 11:65659569-65659591 GAAGCCAGAGCGCCTCTTGCAGG + Intronic
1084898712 11:72294152-72294174 GAAAGCAGTGGGCCACATGCAGG - Intronic
1084996476 11:72984621-72984643 GAAGCCTGGCAGCCACAGCCAGG + Intronic
1086505277 11:87497858-87497880 GAAGCCAGGGAGCCGAAGCCAGG + Intergenic
1088853140 11:113721816-113721838 GAAACCTGGTAGCCACATGGGGG - Intergenic
1091749699 12:3014703-3014725 GGAGCCAGGGAGCCACTAACCGG - Intronic
1092074049 12:5658143-5658165 GAACCCAGGCAGCCACCTCCAGG - Intronic
1092671664 12:10868475-10868497 GAATCCAAGGTGTCACATGCAGG - Intronic
1093171809 12:15869649-15869671 GAAGCTGGATAGCCACATGCTGG - Intronic
1098179682 12:67832782-67832804 GAAGCAAGGGAGGCAGATGCCGG + Intergenic
1098871910 12:75826030-75826052 GAAGACAGGAAGGCACATACTGG - Intergenic
1102567113 12:113803938-113803960 TAAGCCAAGGATCCACATCCAGG - Intergenic
1103704091 12:122862125-122862147 GAAGGCAGGGAGCCCCACGCTGG - Exonic
1103733265 12:123042593-123042615 GAAGCGAGGGAGCCACCGGCAGG + Intronic
1104066294 12:125310001-125310023 GAAGCCAGGCAGCCACAGGAAGG - Intronic
1104180324 12:126373470-126373492 GAAGCCAGGAAGCCAGAAGGGGG + Intergenic
1104724826 12:131069403-131069425 GAAGCCACGAAGCCACATGGTGG - Intronic
1104802483 12:131564081-131564103 GAAGCCACGAAGCCACATGGTGG + Intergenic
1104896798 12:132168733-132168755 GATGCCAGGGAGCAGGATGCGGG + Intergenic
1106554295 13:30796918-30796940 GGAGCCATGGAGCCACAAGCTGG - Intergenic
1109291505 13:60480823-60480845 CAAGCGAGGGGGCCACATGCAGG + Intronic
1110097361 13:71544928-71544950 GAAGCCAGGCTGTCACATTCTGG - Intronic
1110624172 13:77633138-77633160 GAAGCCAGGCAAACACAGGCCGG + Intronic
1112495327 13:99899380-99899402 GATGCCAGGGAACAACATCCAGG - Intergenic
1112674935 13:101690330-101690352 GAAGCCAATGAGGCACATTCAGG + Intronic
1113294300 13:108941054-108941076 AAAACCAGTGAGCCACAGGCTGG + Intronic
1113728405 13:112622724-112622746 TGAGCCAAGGAGCCACAAGCTGG + Intergenic
1113867577 13:113537342-113537364 GAGGCCATGGAGCCACTTCCTGG + Intronic
1113914359 13:113861950-113861972 AAAGCCACTCAGCCACATGCAGG + Intronic
1114228160 14:20757443-20757465 TAAGCCAGATAGCCAGATGCAGG + Intergenic
1114555450 14:23559643-23559665 AAAGCCAGAGCGCCACCTGCTGG + Exonic
1119421450 14:74510029-74510051 GAGGGGAGGGAGCCACAAGCTGG + Intronic
1120119932 14:80666982-80667004 GAAGCCAGAAAGCCACTTCCAGG + Intronic
1121178198 14:91906711-91906733 GAGGCGAGGGAGCTACATGTGGG + Intronic
1122136411 14:99635401-99635423 GAAGCCGGGGAATCAGATGCGGG + Intergenic
1122301587 14:100734208-100734230 GAAGCCAGGGGGGCACAGGCAGG - Exonic
1123853573 15:24384208-24384230 CAAGCCAGAGAGCCAAATTCAGG - Intergenic
1124119973 15:26880755-26880777 GAAACCAGGGAGTCACGTGGAGG - Intronic
1125826628 15:42682038-42682060 GAGTCCAGGCAGCCACAAGCAGG + Intronic
1126087611 15:45024088-45024110 CAAGCCAGGGAGCAAAAGGCAGG - Intronic
1126097456 15:45099642-45099664 GAAGCCTGGGAGTCACGTACTGG + Exonic
1128063094 15:64747556-64747578 GCAGCCAGGCAGCCACAGGAAGG - Intronic
1128799281 15:70487241-70487263 GAGGCCAGGAAACCACAAGCAGG + Intergenic
1131422586 15:92319652-92319674 GAGTTCAGGGAGCCCCATGCAGG + Intergenic
1131735334 15:95326010-95326032 GAAGCCTTGAAGCCACCTGCAGG + Intergenic
1132049221 15:98592884-98592906 GCAGCCAGGGATCCAGGTGCAGG - Intergenic
1132598086 16:762268-762290 GAGGGAAGGGAGCCACATCCAGG + Intronic
1132981945 16:2742738-2742760 GGAGCCAGGGGGACACATGAAGG + Intergenic
1133190772 16:4132130-4132152 GATACCAGGGTGCAACATGCTGG + Intergenic
1133201459 16:4206898-4206920 GAAGCCAGGGAACCCCAGGAAGG - Intronic
1133201517 16:4207060-4207082 GAAGCCAGGGAGCCCCAGGAAGG - Intronic
1134656158 16:15949747-15949769 GAAGCCCCGGAGCGCCATGCCGG - Exonic
1135663842 16:24318862-24318884 GCAGCCAGGGAGCCTCCTACTGG - Intronic
1136984347 16:35084941-35084963 GGAGCCAGGGAGGGAGATGCGGG - Intergenic
1138353272 16:56358003-56358025 GATGCCAGGAAGCCCCCTGCAGG + Intergenic
1138393244 16:56685089-56685111 CAGGACAGGCAGCCACATGCTGG - Intronic
1140514169 16:75530304-75530326 GAACCGTGGCAGCCACATGCGGG + Exonic
1141010726 16:80395930-80395952 GAAGCCAGGCAGCCACGTGGAGG - Intergenic
1141772725 16:86100994-86101016 GAAGCCAGTTAGCCACAGGCAGG + Intergenic
1144754636 17:17671666-17671688 CAAGCCAGGGAGCCACATACTGG + Intergenic
1148234172 17:45956352-45956374 GAAGCCAGGGACCCGCATGCTGG - Intronic
1150345824 17:64403947-64403969 CAAGCCAGGCAGACACAGGCAGG - Intronic
1150486226 17:65545852-65545874 TATTCCAGGGAGCCACATGCCGG - Intronic
1151600010 17:75100294-75100316 GCAGCCAGGCAGCCAAGTGCAGG - Exonic
1151623537 17:75262023-75262045 GAAGGAAGGGGGCCACAGGCAGG + Intronic
1152005189 17:77676165-77676187 GAAGCCAGGGCTGCAAATGCAGG - Intergenic
1152324791 17:79629296-79629318 AAAGCCAGGGCCACACATGCTGG + Intergenic
1152375923 17:79919028-79919050 GAAGCCAGGGAGCCACATGCTGG - Intergenic
1152519284 17:80845891-80845913 GACGCCAGGGAGCAACGTCCAGG - Intronic
1152540336 17:80971475-80971497 GAGGCCAGGGACACTCATGCAGG + Intergenic
1152682635 17:81677007-81677029 CCAGCCAGGGAGCCCTATGCAGG - Intergenic
1152899104 17:82929805-82929827 GAGCCCAGGTACCCACATGCAGG - Intronic
1154122980 18:11666551-11666573 GTAGCTGGGAAGCCACATGCTGG - Intergenic
1155263253 18:24065633-24065655 GGAGCCAGGGATCCATATGTGGG + Intronic
1156368573 18:36451950-36451972 GAAAAAAAGGAGCCACATGCAGG - Intronic
1157204923 18:45689649-45689671 GAAGCCATGGAGCCAGCTGCAGG - Intergenic
1163005869 19:14396417-14396439 GAAGCCAGGCAGGCACTGGCAGG - Exonic
1163031187 19:14545316-14545338 CCCGCCAGGGAGCCTCATGCTGG + Intronic
1163132736 19:15285935-15285957 AGAGCCAGAGAGCAACATGCTGG + Intronic
1165417259 19:35702494-35702516 GACGCCAGGGCGCCTCAAGCAGG - Intergenic
1166165830 19:40987674-40987696 GAAGCCAAAGAGCCACAAGGCGG - Intergenic
1167679113 19:50908762-50908784 AGAGCCAGGGAGCCAGATGGTGG - Exonic
1168250845 19:55141127-55141149 GATGCAAGGGATCCACATGGAGG + Intronic
1168324556 19:55531290-55531312 GAAGCCACGGAGGGACGTGCGGG + Exonic
925928350 2:8685917-8685939 GGAGCCCGGGCGCCACCTGCTGG + Intergenic
926167886 2:10532823-10532845 TGAGCCAGGGAGTCACAGGCTGG - Intergenic
927282122 2:21318042-21318064 GAAGCCATGGAGCATCCTGCGGG + Intergenic
927651977 2:24918832-24918854 GAAGCGAGGCAGGCACAGGCAGG + Exonic
929551415 2:42895484-42895506 GAACCCAGAGGGCCACATGGGGG + Intergenic
929613567 2:43290383-43290405 CAAGCCAGGGAGCCAAACGTAGG - Intronic
931876216 2:66516235-66516257 GAAGCACGGGAGCTCCATGCAGG - Intronic
932495013 2:72141934-72141956 GAGGCCTGAGAGCCAAATGCAGG - Intronic
933829180 2:86192847-86192869 AAAGGCAGTGAGGCACATGCTGG + Intronic
934526840 2:95057304-95057326 GAAGCAAGGGGGCCACAGCCTGG - Intergenic
934947240 2:98550629-98550651 AAAACCAGGCAGCCACATGAGGG - Intronic
936986248 2:118313691-118313713 GAAGCCAGGTAGCCCCCTGGTGG - Intergenic
940793108 2:158048823-158048845 GAAGGCAGAAAGCCACATGAGGG + Intronic
942498724 2:176565867-176565889 GAAGCCAGGCAGCCAAAAGGAGG - Intergenic
944301295 2:198127828-198127850 AAAGCAGGGGAGCCACCTGCTGG + Intronic
945068249 2:205965348-205965370 GAAGCCAGGAAGGCACAAACAGG + Intergenic
945723606 2:213448620-213448642 GAAGTCAGGGACCCAAATGGAGG + Intronic
947592560 2:231393966-231393988 GAAGCCAGGGCCACACTTGCAGG + Intergenic
947820163 2:233063743-233063765 CAAACCAGGCAGCCACCTGCTGG - Intronic
948124597 2:235555491-235555513 GCAGCCAGTGACCCCCATGCCGG - Intronic
948299310 2:236890084-236890106 CAAGCCAGGGAGCCAGCTCCAGG - Intergenic
948468243 2:238162328-238162350 GAAGCCAGTGAGCCCCCTGTGGG - Intronic
1168846984 20:952014-952036 GAAGGGAGGGAGTCACATGGGGG + Intergenic
1170616524 20:17956995-17957017 GAAGCGAGGGATCAACATTCAGG + Exonic
1171339850 20:24419374-24419396 GAAACCAGAGCCCCACATGCTGG + Intergenic
1172619597 20:36310267-36310289 GCAGGAAGGCAGCCACATGCTGG + Intronic
1173163589 20:40670733-40670755 GAAGCCAGGAAGCCTCACCCAGG - Intergenic
1173595698 20:44257486-44257508 GGAGCCACAGAGCCACAGGCAGG + Intronic
1173718978 20:45236589-45236611 GAAGACAGGGCGGCAGATGCTGG + Intergenic
1173953613 20:47013138-47013160 CAAGACAGGGAGCCACATATGGG + Intronic
1174890798 20:54389797-54389819 GAAGTCAGGAAACCAAATGCTGG + Intergenic
1175055259 20:56192067-56192089 GAAGACAGGAAGGCACATCCTGG - Intergenic
1175802897 20:61811280-61811302 GAAAGCTGGGATCCACATGCCGG + Intronic
1177492709 21:21848374-21848396 GCAGCCAGGGAGCCAAGAGCAGG + Intergenic
1178396514 21:32248099-32248121 GTAGCCTGGGAGCCACAGGGAGG - Intergenic
1179460899 21:41534357-41534379 GAATCCAGTGAGCACCATGCTGG - Intergenic
1179513782 21:41892502-41892524 GAACCCAGGCAGCAACATGGAGG + Intronic
1179789365 21:43747609-43747631 GAAGGCAGGGAGCTGCAAGCTGG - Intronic
1179865387 21:44213591-44213613 GAAGCCAGGGAGGAAAACGCGGG - Intergenic
1179973454 21:44849225-44849247 GGAGCGCGGGAGCCTCATGCAGG + Intergenic
1180139157 21:45880805-45880827 GAAGCCAGGGAGCCAGCGGGAGG + Intronic
1180214041 21:46313666-46313688 GAAGACAGGAAGGCACAGGCTGG + Intronic
1181508571 22:23378554-23378576 GAGGTGAGGGAGCCACATGGTGG + Intergenic
1181794017 22:25290735-25290757 GGGGTCAGGGAGCCTCATGCTGG - Intergenic
1183235502 22:36613993-36614015 GAAGCAGGGGAGCCACTTGGGGG - Intronic
1183986657 22:41573975-41573997 GAAGCCTGGGAGCCAGCGGCTGG + Intronic
1185116337 22:48940385-48940407 GAAGCCAGGCAGTGACATCCAGG + Intergenic
949152064 3:781303-781325 AAGGCCAAGGAGCCACATTCTGG - Intergenic
952092484 3:29905840-29905862 GCAGCCAGTGGGCCACATGTTGG + Intronic
952832888 3:37579798-37579820 CAAGCCAGGGGCCCACATGTTGG + Intronic
954751094 3:52814113-52814135 GAAGCCTGGGAGACACACGCAGG + Intronic
955344752 3:58152798-58152820 GAGGCCAGGCGGCCGCATGCGGG - Intronic
955860699 3:63326619-63326641 GAAGCCCAGAAGCCAGATGCTGG + Intronic
956098997 3:65747928-65747950 GAAGCCAGTGAGCCAAATGCTGG + Intronic
960121698 3:113953844-113953866 AATGCCAGGAAGCCACATGAAGG - Exonic
961376023 3:126466417-126466439 GTAGCCAGGGTGCAAAATGCAGG - Intronic
961659234 3:128459582-128459604 GAACCCAGGGAGCCACAACCTGG + Intergenic
961970736 3:130963726-130963748 GAAGCCAGGGATACAAATCCAGG + Intronic
962804355 3:138916122-138916144 GAAGTCAGGGCGCCACCTGGCGG + Intergenic
962835417 3:139184929-139184951 GCAGCCATGGAGCTACATGTTGG + Intronic
965259268 3:166459372-166459394 GAGTCCAGGGAGACACATGAAGG - Intergenic
967510599 3:190306815-190306837 GAAGGCACTGAGCCACATGAAGG + Exonic
968737362 4:2304334-2304356 GAGGCCAGAGAGCTGCATGCTGG - Exonic
969622658 4:8286536-8286558 GCAGCCAGGGAGACACAGGCGGG - Intronic
973733880 4:53850946-53850968 CAGGGCAGGGACCCACATGCAGG - Intronic
974951897 4:68592965-68592987 GAAGGCAGAAAGCCACAAGCTGG + Intronic
974998347 4:69191816-69191838 GAAGTCAGGGACCCAAATGGAGG + Intronic
975625702 4:76344570-76344592 GAAGCGAGGGATCAACATTCAGG - Intronic
978061567 4:104345613-104345635 CCAGCCTGGGAGCCACAGGCTGG + Intergenic
982019025 4:151185207-151185229 GAAGCCAGGGAACAAAGTGCAGG + Intronic
983650712 4:170033696-170033718 GAAGTCAGGGAGAAACATGTTGG - Intergenic
984866151 4:184282343-184282365 GACTCCAGGGTGCGACATGCAGG - Intergenic
985635854 5:1035633-1035655 TCAGCCAGGGTGCCAGATGCTGG - Intronic
985657437 5:1139520-1139542 GCAGCAATGGTGCCACATGCCGG + Intergenic
985664524 5:1175129-1175151 GAAGCGATGGAGCTGCATGCAGG - Intergenic
985789732 5:1919035-1919057 CAGGCCATGCAGCCACATGCAGG - Intergenic
985976398 5:3421580-3421602 GAAGCGACTGAGCCACATCCTGG + Intergenic
986888057 5:12265088-12265110 GAAACCAGGCAGCCCCATTCTGG + Intergenic
987009519 5:13747541-13747563 AAAGTCAGGAAGCAACATGCTGG - Intronic
987370415 5:17187776-17187798 GAAGCAAGGAAGCCACAGGGTGG + Intronic
988057694 5:26121531-26121553 GAAGCCATGTAGCCACACGGAGG + Intergenic
988468367 5:31512969-31512991 GGAGCCAGTGAGGCCCATGCTGG + Intronic
995418580 5:111937003-111937025 GAAGTCAGGGAGACAGATGCTGG - Intronic
995551150 5:113282853-113282875 GCAGCCAGGAAGTCACAGGCTGG - Intronic
996898119 5:128510342-128510364 GAAGCCTGTGAGCCACAGGTGGG + Intronic
998811368 5:145969859-145969881 CAGGCCAAGGAACCACATGCTGG - Intronic
999197596 5:149793106-149793128 GAAGGCAGGGAACCACAGGGAGG - Intronic
999390602 5:151186784-151186806 GAAGCCAGTGAGCCACCTTAAGG - Intronic
1000840855 5:166216382-166216404 GAAGCCAACAAGCCACGTGCAGG - Intergenic
1001130395 5:169058987-169059009 AAAGCCAGGGACCCAAATGCTGG + Intronic
1001677227 5:173528675-173528697 GCAGCCATGGAGTCACATGCTGG + Intergenic
1003514389 6:6805985-6806007 TAAGACAGGGAGACACATGGAGG + Intergenic
1005173410 6:23014709-23014731 AAAGCCAGGGAACCACATGCTGG + Intergenic
1005408279 6:25515414-25515436 GAAGCCAGGGAAAGACATGCAGG - Intronic
1006297881 6:33178112-33178134 GAAGTCAGGGAGTCACTTACAGG + Exonic
1007693375 6:43716966-43716988 GAAGACAGGGAGGCATATGGAGG + Intergenic
1007714267 6:43845296-43845318 GAAGCCATGAAGACACATCCAGG - Intergenic
1012145379 6:95673705-95673727 GAAGCCAAAGAGCCTCTTGCTGG + Intergenic
1012290839 6:97453586-97453608 GCAGCCAGGGAGCAATATGATGG + Intergenic
1012725125 6:102801274-102801296 GAGGCCTGTGAGACACATGCTGG - Intergenic
1015718036 6:136211967-136211989 GTAGCCTGGGAGCTTCATGCTGG + Intergenic
1017791279 6:157801869-157801891 GAAGACAGGAAGCAACATGATGG + Intronic
1017997111 6:159541680-159541702 GAACCCAGGCAGCCAGATTCTGG + Intergenic
1018160826 6:161041011-161041033 GAAGCCTGGGAGCCACCTGGAGG + Intronic
1018784616 6:167098462-167098484 GAGGCCAGGGAACCAGGTGCGGG - Intergenic
1018961105 6:168449108-168449130 GGACACAGGGAGCCACAGGCAGG - Intronic
1019275074 7:171851-171873 GAAGACAGGAAGCCAGAGGCAGG - Intergenic
1019455009 7:1122462-1122484 GAAGCCACGGAGCCGTATGCGGG - Intronic
1019681066 7:2349943-2349965 GTAGCCTGGGAGCCTCATGCTGG - Intronic
1020274863 7:6617698-6617720 GAAGCCAGGGAGCCAACATCTGG - Intronic
1020435257 7:8155442-8155464 GAGGCCAGGGATACACATGTGGG + Intronic
1020846616 7:13293290-13293312 GAAGCCAGGAGGCCAGATTCTGG - Intergenic
1023605837 7:41929855-41929877 GAAGGAAGGTAGCTACATGCAGG + Intergenic
1026364053 7:69629705-69629727 GTAGCCTGTGAGCCACATGAGGG + Intronic
1027184680 7:75963743-75963765 GTTCCAAGGGAGCCACATGCTGG + Intronic
1028154151 7:87410447-87410469 GAAGCTATGCAGCCACATGTGGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029220907 7:98989460-98989482 GAAGACAGGAAGCCACATGAAGG - Intronic
1031168772 7:118264600-118264622 GAAGCCACCGAGCCACATCACGG - Intergenic
1032604079 7:133330386-133330408 GAAGCCAGGGAGCGAAGTTCTGG - Intronic
1034954065 7:155322485-155322507 GAAGCCAGGGAAGACCATGCAGG + Intergenic
1034997438 7:155587086-155587108 GCAGCCAGGGTGGCACATGATGG + Intergenic
1039378876 8:37066364-37066386 GAAGGCTGTGAGCCAGATGCTGG + Intergenic
1040743886 8:50616548-50616570 GCAGGCAGGAAGCCACAGGCAGG + Intronic
1041948867 8:63477619-63477641 GCAGCTAGGAAGCCACCTGCTGG + Intergenic
1044835718 8:96293523-96293545 GCAGCCAGAGAGCTGCATGCAGG - Intronic
1045476051 8:102553661-102553683 GAAGCCAGGAAGACAGAGGCTGG - Intronic
1045564830 8:103303142-103303164 GCAGCCAGGGTCCCACATGAAGG - Intronic
1049451976 8:142666847-142666869 GAAGCCAGGAAGTCCGATGCTGG + Intronic
1050561003 9:6834496-6834518 GAAGCCAGCCTTCCACATGCCGG - Intronic
1050655665 9:7825965-7825987 GAAGCAAGGGAGGCATATGATGG + Intronic
1056475454 9:86947424-86947446 GAAGCCAGGGAGCCGCTCTCCGG - Intergenic
1056807450 9:89740031-89740053 GGAGACAGGGATCCACGTGCTGG + Intergenic
1057299563 9:93870061-93870083 GAAGCCTGAGAGCCAGCTGCTGG + Intergenic
1057385501 9:94602726-94602748 GAGGCCAGAGGGTCACATGCAGG + Intergenic
1057825507 9:98369655-98369677 GTAGCCAGGGAGCAAAATGCAGG + Intronic
1057886705 9:98835044-98835066 GAAGCCTGGGAGCCACCTCAAGG + Intronic
1057959913 9:99445308-99445330 GAAGCTAGAGAGCCAGCTGCTGG + Intergenic
1059421799 9:114196833-114196855 GAAGGAAGGGAGACACAGGCTGG - Intronic
1060509614 9:124222385-124222407 GAAGCTAGGGACCCAGATCCTGG - Intergenic
1060777022 9:126382255-126382277 CAAGCCAGAGAGCCACATGATGG - Intronic
1061295179 9:129672976-129672998 GAAGTCTGGGAACCACAGGCCGG - Intronic
1061588534 9:131583723-131583745 GAGGCCAGGGGACCACATCCCGG - Intronic
1061885081 9:133587351-133587373 GAAGCCCTGGAGCCATAAGCAGG + Intergenic
1062070270 9:134551673-134551695 GCAGGAAGGGGGCCACATGCAGG - Intergenic
1062595365 9:137296715-137296737 GAAGCCAGGGAGACGGGTGCAGG - Intergenic
1185694598 X:2185900-2185922 GAAGGCGGTGAGCCACTTGCCGG - Intergenic
1186226281 X:7402336-7402358 GAAGCCAGAAAGCCTCATTCTGG + Intergenic
1187595790 X:20771489-20771511 GGACCCAGTGAGCCAGATGCAGG - Intergenic
1189390327 X:40570897-40570919 GAAGGTGGGCAGCCACATGCTGG + Intergenic
1190053584 X:47169675-47169697 GAAGCCAGGGAGACCCAGGTTGG - Intronic
1192158301 X:68763169-68763191 GAAGCCTTGAAGCCAGATGCTGG - Intergenic
1195706198 X:107739589-107739611 GAAGCCAGGAAGCCAGAGTCTGG + Intronic
1195966195 X:110432279-110432301 CAAGACGGGGAGCCACATGGCGG + Intronic
1199724731 X:150568845-150568867 GAGGCCAGGGAGCAGCAGGCAGG + Intronic
1200696998 Y:6369806-6369828 GAAGTCATTGAGCCAGATGCAGG + Intergenic
1201037115 Y:9794893-9794915 GAAGTCATTGAGCCAGATGCAGG - Intergenic