ID: 1152376433

View in Genome Browser
Species Human (GRCh38)
Location 17:79921088-79921110
Sequence CTGGAGCTGCTCTCCGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152376433_1152376439 1 Left 1152376433 17:79921088-79921110 CCAGCGCCGGAGAGCAGCTCCAG No data
Right 1152376439 17:79921112-79921134 AAGGACTTCCCGGCTGGCTCTGG No data
1152376433_1152376437 -5 Left 1152376433 17:79921088-79921110 CCAGCGCCGGAGAGCAGCTCCAG No data
Right 1152376437 17:79921106-79921128 TCCAGCAAGGACTTCCCGGCTGG No data
1152376433_1152376441 3 Left 1152376433 17:79921088-79921110 CCAGCGCCGGAGAGCAGCTCCAG No data
Right 1152376441 17:79921114-79921136 GGACTTCCCGGCTGGCTCTGGGG No data
1152376433_1152376436 -9 Left 1152376433 17:79921088-79921110 CCAGCGCCGGAGAGCAGCTCCAG No data
Right 1152376436 17:79921102-79921124 CAGCTCCAGCAAGGACTTCCCGG No data
1152376433_1152376440 2 Left 1152376433 17:79921088-79921110 CCAGCGCCGGAGAGCAGCTCCAG No data
Right 1152376440 17:79921113-79921135 AGGACTTCCCGGCTGGCTCTGGG No data
1152376433_1152376442 7 Left 1152376433 17:79921088-79921110 CCAGCGCCGGAGAGCAGCTCCAG No data
Right 1152376442 17:79921118-79921140 TTCCCGGCTGGCTCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152376433 Original CRISPR CTGGAGCTGCTCTCCGGCGC TGG (reversed) Intergenic
No off target data available for this crispr