ID: 1152376832

View in Genome Browser
Species Human (GRCh38)
Location 17:79922892-79922914
Sequence CCGTGGTGCACTGTAGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152376832_1152376837 9 Left 1152376832 17:79922892-79922914 CCAACAGCTACAGTGCACCACGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1152376837 17:79922924-79922946 ACCGCACTCAGTGCTCTGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152376832 Original CRISPR CCGTGGTGCACTGTAGCTGT TGG (reversed) Intergenic
901283057 1:8054647-8054669 GCTTGGTACACTGTACCTGTGGG + Intergenic
907911931 1:58834504-58834526 CCATGGTGCACAGTGGCTGGAGG - Intergenic
916235223 1:162580604-162580626 CAGTGGTGCTCTCTAGATGTAGG + Intronic
918306525 1:183251649-183251671 CCTTTGTGGACTGTAGCTGATGG - Exonic
924380043 1:243454486-243454508 CTGTGGTGCACGGGGGCTGTGGG - Intronic
1063140431 10:3251811-3251833 GGGTGCTGCACTGTAGATGTGGG - Intergenic
1063140436 10:3251855-3251877 GGGTGCTGCACTGTAGATGTGGG - Intergenic
1063140535 10:3252644-3252666 GGGTGCTGCACTGTAGATGTGGG - Intergenic
1074895640 10:117775228-117775250 CTGGGGAGCACTGTTGCTGTGGG - Intergenic
1076239636 10:128894684-128894706 CCATGGGGCACTGTTGATGTGGG + Intergenic
1085665937 11:78416516-78416538 CCTTGATGCACTGCAGCTGGAGG + Intronic
1086562084 11:88179256-88179278 CCATGGTGCAGTGTGGCTGCTGG - Intergenic
1091834568 12:3576579-3576601 CCCTGCTGCACTCTAGCTATAGG + Intronic
1096303656 12:50454840-50454862 CTGTTGTGCACTGTAGTTCTTGG - Intronic
1103012166 12:117465909-117465931 CCCTGGTGTTCTGTATCTGTAGG - Exonic
1103328080 12:120134769-120134791 CTGTGGTACACTGTGGCTTTGGG - Intronic
1103920490 12:124396787-124396809 CCGTCCTCCACTGTAGTTGTGGG - Intronic
1104717728 12:131027136-131027158 CCTTGGTGCACTGTAGATCCAGG + Intronic
1105429110 13:20321012-20321034 CTGTGCTGCACTGTGCCTGTTGG - Intergenic
1110569438 13:76988774-76988796 CTGTGGTTCACTGTAGCTTAAGG + Intergenic
1113274158 13:108709450-108709472 ACGTGGTTCCCTGAAGCTGTAGG - Intronic
1122489064 14:102101332-102101354 CCGTGGTTCACTGTGACTTTTGG + Intronic
1122611613 14:102987213-102987235 ACGTGCTGCTCTGTAACTGTGGG - Intronic
1124357056 15:29003546-29003568 CAGTGGTGCACTGAAACAGTAGG + Intronic
1129309551 15:74696367-74696389 CCGTGCTAAACTGCAGCTGTGGG + Intergenic
1139162795 16:64532142-64532164 CCCTGGTACACTGTAGTTATTGG + Intergenic
1140325404 16:73996581-73996603 CCCTGGAGCTCTGTAGCTGTTGG + Intergenic
1151185949 17:72363950-72363972 CCATGCAGCTCTGTAGCTGTTGG - Intergenic
1152376832 17:79922892-79922914 CCGTGGTGCACTGTAGCTGTTGG - Intergenic
1152607479 17:81300023-81300045 CTGTGGTGCACAGTGGCCGTGGG + Intergenic
1155258423 18:24018510-24018532 CGGTGCTGCAATGTAGGTGTAGG + Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
926918422 2:17915553-17915575 CTGTGGTGCACCTTAGGTGTAGG + Intronic
931666310 2:64611892-64611914 CCCTGATGCCCTGTAGCTTTGGG + Intergenic
931901236 2:66790693-66790715 ACTTGCTGCACTGGAGCTGTGGG - Intergenic
932113880 2:69027130-69027152 CCTTGGAGCCCTGTTGCTGTTGG + Intronic
933092977 2:78145464-78145486 ATGTGGTGCACAGGAGCTGTGGG - Intergenic
938109508 2:128554409-128554431 CGGTGGTGCACTGTCTCTCTGGG + Intergenic
941210041 2:162626054-162626076 TCGTGGAGTACTGTAGATGTGGG + Intronic
942291303 2:174474245-174474267 CAATGGTCCACAGTAGCTGTGGG + Intronic
1174100650 20:48123963-48123985 CCGTGCTGCTATGTAACTGTGGG - Intergenic
1177117261 21:17101488-17101510 CCATGTTGCACTGTAGCTGAGGG - Intergenic
1179900815 21:44392882-44392904 CCAGGGTGCACTGCAGCTGTGGG + Intronic
1184842242 22:47058791-47058813 CCGTGTTGCTCTGTGACTGTTGG + Intronic
1185315751 22:50178454-50178476 CCGTGGGCCGCTGTGGCTGTGGG - Intronic
952335597 3:32400802-32400824 CCATGGTACACTGTGGCTCTGGG + Intronic
960083539 3:113566786-113566808 CCGTGATCCTCTGTAGCTTTGGG + Intronic
961382963 3:126507988-126508010 CCGTGGGGCACTGCGGCTGCTGG + Exonic
962367174 3:134794368-134794390 GCGAGGTGCACTGTTGCTGTGGG - Intronic
967718766 3:192793014-192793036 CTGTGCTCCACTGTAGGTGTTGG + Intergenic
969506147 4:7589069-7589091 CCCTGGTGCACAGGAGGTGTGGG + Intronic
978962372 4:114698107-114698129 CAGTGGAGCAATGTTGCTGTTGG + Intergenic
985587980 5:750787-750809 CTGTGGGGCCATGTAGCTGTGGG - Intronic
985710922 5:1429372-1429394 ACGTGGTACACTTTAGCTGGCGG - Intronic
987194983 5:15517385-15517407 CCGTGGTGAGCTTTGGCTGTGGG + Intronic
989280760 5:39640417-39640439 TCGTGGTCCAGTGTAGCTGCTGG - Intergenic
994981699 5:106882946-106882968 CAGTGGTGAACTAAAGCTGTAGG + Intergenic
1004172095 6:13303045-13303067 CCTTCTTGCACTGTAGCTCTGGG - Intronic
1006196722 6:32247527-32247549 GCTTGCTGCACCGTAGCTGTGGG - Intergenic
1009803498 6:68572935-68572957 CCCTGATGCACTGTAGCTGTGGG + Intergenic
1014522062 6:122456481-122456503 CCATTGTGCACTGCAGCTCTAGG + Exonic
1022421101 7:30224204-30224226 CAGTGGTGGATTGTGGCTGTGGG + Intergenic
1024210850 7:47202267-47202289 CTGTGGACCACTGGAGCTGTAGG - Intergenic
1025233854 7:57220459-57220481 CCGTGCTGCTATTTAGCTGTGGG + Intergenic
1033995196 7:147337283-147337305 CTGTGTTGCACTGCAGCTGAGGG + Intronic
1037576231 8:20206394-20206416 CCGAGTTGGACAGTAGCTGTGGG - Intronic
1037637826 8:20716334-20716356 ACCTGCTGCACTGTAGCTGCTGG + Intergenic
1042164143 8:65929483-65929505 TTGTGGTGCACTGTGGTTGTTGG + Intergenic
1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG + Intronic
1060775958 9:126374661-126374683 TTTTGGTGGACTGTAGCTGTGGG + Intronic
1187688527 X:21840101-21840123 CCCTGCTGCACTGCAGCTGCTGG - Intronic
1192211788 X:69132507-69132529 CTGTTGTGCCCTGTGGCTGTTGG - Intergenic
1196968878 X:121087117-121087139 GCATGATGCACTCTAGCTGTGGG + Intergenic