ID: 1152377359

View in Genome Browser
Species Human (GRCh38)
Location 17:79925652-79925674
Sequence TGGGGGTTCCCCCAGCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152377343_1152377359 23 Left 1152377343 17:79925606-79925628 CCTAGTGTAGGGCCTCCTGCCAG No data
Right 1152377359 17:79925652-79925674 TGGGGGTTCCCCCAGCAGGTTGG No data
1152377352_1152377359 -3 Left 1152377352 17:79925632-79925654 CCGGCACCTACTTGTGGGGCTGG No data
Right 1152377359 17:79925652-79925674 TGGGGGTTCCCCCAGCAGGTTGG No data
1152377346_1152377359 11 Left 1152377346 17:79925618-79925640 CCTCCTGCCAGTGGCCGGCACCT No data
Right 1152377359 17:79925652-79925674 TGGGGGTTCCCCCAGCAGGTTGG No data
1152377347_1152377359 8 Left 1152377347 17:79925621-79925643 CCTGCCAGTGGCCGGCACCTACT No data
Right 1152377359 17:79925652-79925674 TGGGGGTTCCCCCAGCAGGTTGG No data
1152377357_1152377359 -9 Left 1152377357 17:79925638-79925660 CCTACTTGTGGGGCTGGGGGTTC No data
Right 1152377359 17:79925652-79925674 TGGGGGTTCCCCCAGCAGGTTGG No data
1152377348_1152377359 4 Left 1152377348 17:79925625-79925647 CCAGTGGCCGGCACCTACTTGTG No data
Right 1152377359 17:79925652-79925674 TGGGGGTTCCCCCAGCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152377359 Original CRISPR TGGGGGTTCCCCCAGCAGGT TGG Intergenic
No off target data available for this crispr