ID: 1152378477

View in Genome Browser
Species Human (GRCh38)
Location 17:79930387-79930409
Sequence CCGGCCCACCTGAGGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152378477_1152378487 -10 Left 1152378477 17:79930387-79930409 CCCCAAGGCCTCAGGTGGGCCGG No data
Right 1152378487 17:79930400-79930422 GGTGGGCCGGGGGCTCCGGGAGG No data
1152378477_1152378497 27 Left 1152378477 17:79930387-79930409 CCCCAAGGCCTCAGGTGGGCCGG No data
Right 1152378497 17:79930437-79930459 CGTCCCAGGAGAGCAGTTCCCGG No data
1152378477_1152378491 13 Left 1152378477 17:79930387-79930409 CCCCAAGGCCTCAGGTGGGCCGG No data
Right 1152378491 17:79930423-79930445 CCTCCGCCGCCCTCCGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152378477 Original CRISPR CCGGCCCACCTGAGGCCTTG GGG (reversed) Intergenic
No off target data available for this crispr