ID: 1152380676

View in Genome Browser
Species Human (GRCh38)
Location 17:79940985-79941007
Sequence GGTGCACTCCACCGCGGGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152380665_1152380676 12 Left 1152380665 17:79940950-79940972 CCGTAGGGACAGCTCTCCGAGCC 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 70
1152380671_1152380676 -4 Left 1152380671 17:79940966-79940988 CCGAGCCGGGATGGTGGCCGGTG 0: 1
1: 0
2: 2
3: 29
4: 1421
Right 1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 70
1152380660_1152380676 23 Left 1152380660 17:79940939-79940961 CCACCGTGCCCCCGTAGGGACAG 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 70
1152380662_1152380676 15 Left 1152380662 17:79940947-79940969 CCCCCGTAGGGACAGCTCTCCGA 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 70
1152380661_1152380676 20 Left 1152380661 17:79940942-79940964 CCGTGCCCCCGTAGGGACAGCTC 0: 1
1: 0
2: 0
3: 12
4: 82
Right 1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 70
1152380664_1152380676 13 Left 1152380664 17:79940949-79940971 CCCGTAGGGACAGCTCTCCGAGC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 70
1152380672_1152380676 -9 Left 1152380672 17:79940971-79940993 CCGGGATGGTGGCCGGTGCACTC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 70
1152380663_1152380676 14 Left 1152380663 17:79940948-79940970 CCCCGTAGGGACAGCTCTCCGAG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152380676 Original CRISPR GGTGCACTCCACCGCGGGCA TGG Exonic
902243824 1:15106134-15106156 GGTGCACTCCACCACCTCCAGGG - Intronic
909672320 1:78203237-78203259 GGTGCAGCCCACAGAGGGCAAGG + Intergenic
909966061 1:81912107-81912129 ACTGCACTCCAGCGTGGGCAAGG - Intronic
912100743 1:106201422-106201444 GCTGCTCTCCACCCCTGGCAGGG + Intergenic
919368057 1:196690691-196690713 AGTGCACTCCACCAGGGGCAGGG - Intronic
920227501 1:204449219-204449241 GGTGCACTCCAACGGGCGCTGGG + Exonic
921181272 1:212633464-212633486 GGTGTAGTCCACCGCAGGCTGGG + Intergenic
1062857571 10:786916-786938 GGTGGACTCGGCCGCGGACAAGG - Intergenic
1063566000 10:7172500-7172522 CGTGGACTTCACCGCGGGCTCGG - Exonic
1076886920 10:133267261-133267283 TGTGCACTGCACCGGGGGCCAGG - Intronic
1081196374 11:40165905-40165927 ATTGCACTCCAGCCCGGGCAAGG + Intronic
1086150355 11:83602369-83602391 GGTGCCATCCACTGCCGGCATGG - Intronic
1088522354 11:110712773-110712795 GGCGCCTTCCGCCGCGGGCACGG - Intronic
1117072668 14:52069922-52069944 GATGCCCTCCCCCGCGGCCACGG + Intergenic
1117707594 14:58487566-58487588 ATTGCACTCCACCCTGGGCAAGG + Intronic
1119747924 14:77057698-77057720 ACTGCACTCCAGCCCGGGCAAGG - Intergenic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1121277796 14:92679505-92679527 GGGGCTCTCCAGCGAGGGCAGGG + Intronic
1122980073 14:105187516-105187538 GCTGCACTCCAGCCTGGGCAAGG - Intergenic
1123036605 14:105474397-105474419 GCTGCGCTCCGCCGCGGGAAGGG - Intronic
1129228122 15:74181586-74181608 TGTGCACCCCACCCTGGGCAAGG + Intronic
1136655824 16:31708620-31708642 GCTGCACTCTGCTGCGGGCACGG + Intergenic
1138229917 16:55329254-55329276 GGCTCGCTCCTCCGCGGGCACGG - Exonic
1138818260 16:60227693-60227715 GCTGCACTCCATCCTGGGCAAGG - Intergenic
1141999287 16:87654989-87655011 GTTGCAGTCCCCCGGGGGCATGG + Intronic
1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG + Exonic
1161405896 19:4090925-4090947 GCTGCACTCCACCTGGGGCGGGG + Intronic
1162032117 19:7922034-7922056 GGTGCTCACCATCGCGGCCACGG + Exonic
1163322744 19:16584106-16584128 GGTGCACACCACCGCGCCCGTGG - Intronic
1167135860 19:47615126-47615148 GGTGCACGCCACCACGCCCAGGG + Intronic
1167358093 19:49016260-49016282 GGTGCACACCACCTGAGGCAGGG + Exonic
929919783 2:46163860-46163882 GGTGCACCCCACAGAGGCCACGG + Intronic
930272691 2:49275305-49275327 GGTGCACTCCACTCCGGGATAGG + Intergenic
930840243 2:55837530-55837552 GGTGCAGCCCACAGAGGGCAAGG - Intergenic
935880336 2:107558758-107558780 GGAGCACTCCAGCGGGGACATGG - Intergenic
946483813 2:220081561-220081583 GGTGCACTGCACCGAGTGGAGGG + Intergenic
948609039 2:239155265-239155287 GGTCCACTCCACCTGGGACATGG + Intronic
1170441034 20:16378920-16378942 GAGGCACTCCACCCTGGGCATGG - Exonic
1174445794 20:50590355-50590377 GCTGGACTCCACTGCGGGCCGGG - Intronic
1175927001 20:62475919-62475941 GGAGCACTCACCAGCGGGCAGGG + Exonic
1179979874 21:44890301-44890323 GGTGTTCTCCACCAAGGGCAAGG - Intronic
1183583656 22:38739886-38739908 GGCCCCCTCCACCTCGGGCAAGG + Exonic
1184100663 22:42340376-42340398 GGTGCAGGCTACCGCGGGAAGGG - Intronic
950476068 3:13215694-13215716 ACTGCACTCCACCCCTGGCACGG + Intergenic
953421115 3:42754005-42754027 GCTGCACTCCAGAGAGGGCAAGG - Intronic
954912662 3:54122301-54122323 GGCGCGCTCCGCCGCGGCCAAGG + Intergenic
960890481 3:122442961-122442983 GGTGCAGCCCACGGAGGGCAAGG + Intronic
968849623 4:3070013-3070035 GGTGCACACCAGCCTGGGCAGGG - Intergenic
973772248 4:54217667-54217689 CGTCCATTCCACCGCGGGCCAGG - Intronic
976751859 4:88457305-88457327 CGGGCGCTCGACCGCGGGCAAGG + Exonic
977141410 4:93376812-93376834 TCTGCACTCCACCCCGGGGAAGG - Intronic
991577736 5:68122460-68122482 GGTGCACTCCCACACTGGCAGGG - Intergenic
992268100 5:75037838-75037860 AGTGCACTCCAGCCTGGGCAAGG + Intergenic
997207876 5:132060589-132060611 GGTGCCCACAACCCCGGGCAAGG - Exonic
998364403 5:141619233-141619255 GGTGCTCTCCGCCGCGGCCGCGG - Intergenic
1001529893 5:172454418-172454440 GGGGCGCGCCGCCGCGGGCAGGG + Exonic
1002617124 5:180462892-180462914 AGTGCACTCCATCCTGGGCAAGG - Intergenic
1005940596 6:30556732-30556754 GCTGGACTACACCGGGGGCACGG + Exonic
1007264721 6:40587735-40587757 GGTGCGCTCGGCAGCGGGCAGGG - Intergenic
1007547467 6:42705127-42705149 GGTGGAGTCCTCCGAGGGCAAGG - Intronic
1010837851 6:80612255-80612277 GGTGCAGCCCACAGAGGGCAGGG + Intergenic
1018069390 6:160148882-160148904 ACTGCACTCCAGCCCGGGCAGGG + Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019195647 6:170280974-170280996 GGAGCCCCCCGCCGCGGGCACGG - Intergenic
1026220493 7:68392333-68392355 GGTGCACTCTGCTGCGGGCAGGG - Intergenic
1032394742 7:131581414-131581436 GGTGCCCACCACCGGGGGCAGGG - Intergenic
1039868854 8:41528951-41528973 GGCGCCCGCCACCGCGGCCAAGG - Intergenic
1040520181 8:48169683-48169705 GGTGCAGCCCACAGAGGGCAGGG - Intergenic
1049771262 8:144383111-144383133 GGTGCTCTCCACCGCGGTAGTGG + Exonic
1050461229 9:5879329-5879351 GGTGCACTCCAGCCTGGGAAGGG + Intergenic
1055394393 9:75858613-75858635 GGTGGACTCCACCCCTGGCTGGG + Intergenic
1057659876 9:96991291-96991313 AGTGCACTCCAGCCTGGGCAAGG + Intronic
1058736127 9:107895828-107895850 GGTGCACTCCAACCCACGCAGGG - Intergenic
1061397207 9:130349630-130349652 GGTCCACTCCACCTGGGGCGTGG - Intronic
1197356652 X:125444419-125444441 GGTGCAATCCACGGAGAGCAAGG + Intergenic